Given the following sequence for one strand of a double-stranded oligonucleotide: 5'ACCGTAAGGCTTTAG3' (a) Write the sequence for the complementary DNA strand. (b) Suppose you knew that the strand shown above had phosphate on both ends. Using an accepted nomenclature, write the sequence so as to show this. (c) Write the sequence of the RNA complementary to the strand shown above.
Q: nt #2 nt #3 nt # 4 3. In the following sequence, which of these nucleotides a. would have a free…
A: a) Nucleotides #1 and #5, because the 5’ end of each DNA strand has a triphosphate group.
Q: Describe the structure of nucleotides and the manner in which these monomers are joined to form a…
A: A nucleotide is an organic molecule that is the building block of DNA and RNA and also have…
Q: In proteins, a peptide read from the N terminal to the C terminal. Is there a kind of direction in…
A: The DNA double helix model is generally one of the best discoveries of the 20th century. DNA is…
Q: Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT TA…
A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material containing thousands of…
Q: draw a picture of a SINGLE strand of DNA (a polynucleotide) composed of 9 (nine) nucleotides of your…
A: Nucleic acids are made up of chains of many repeating units called nucleotides. The DNA molecule…
Q: Give the corresponding strand of the DNA having the sequence of: a. 5’…
A: DNA(deoxyribonucleic acid) is the heredity material for most living organisms. It is composed of…
Q: If the sequence of a gene is: 3'TACATACCAACTGAGGATCGC5' 5'ATGTATGGTTGACTCCTAGCG3' And the RNA…
A: DNA is a double stranded helical structure found generally in Eukaryotes and prokaryotes while in…
Q: A double-stranded molecule of B DNA contains 340 nucleotides. How many complete turns occur in this…
A: DNA duplex model proposed by Watson and Crick is right-handedly coiled and is called B-DNA. A DNA…
Q: Suppose the following base sequence was found in a 20-base DNA polymer. 3'СAGTTAC…
A: DNA, or deoxyribonucleic acid, is a biomacromolecule that is responsible for the transmission of…
Q: If you had a protein that developed a mutation that changed its TEMPLATE strand from 5’GAT 3’ to…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: When comparing the structures of RNA and DNA , which of the following statement is True? A-Only RNA…
A: DNA and RNA are two main types of nucleic acids that contain a five-carbon sugar backbone, a…
Q: What is the structure of a DNA molecule? A. Two nucleotide strands coiled into a double helix held…
A: DNA is the genetic material that is responsible for inheritance of characters. It is present in the…
Q: H. HD N. A N- H- H. 0=P-0- CH2 H. H. H. OH) H B. Where would this nucleotide hydrogen-bond to its…
A: Each nucleotide is a monomer of nucleic acid such as RNA and DNA. The RNA and DNA differs from each…
Q: One DNA strand has the sequence 5' -ATTCCGTAGC-3' what is the complementary strand sequence?
A: DNA ( Deoxyribonucleic acid ) is two stranded structure which act as genetic material in most of the…
Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…
A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…
Q: Give the complimentary DNA strand for the following: ACG TAG CTA GTC AGT CGT AGC Give the RNA…
A: NOTE:- Since you have posted a question with multiple sub-parts, we will solve the first three…
Q: . A viral DNA is analyzed and found to have the following base com- position, in mole percent: A =…
A: A simple virions has 2 components that are nucleic acid (Single or double-stranded DNA or RNA) along…
Q: If an RNA strand generates its complementary strand, thus producing a double helix, will a molecule…
A: Nucleic acids are the main information carrying molecules of the cell and by directing the synthesis…
Q: What is the nucleotide sequence of the complementary strand of the DNA molecule:…
A: Nucleic acids are large macromolecules that store hereditary information for cellular growth and…
Q: One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the…
A: The central dogma of molecular biology is the metabolic process in which the double-helical…
Q: Using the Figure below identify: What is the significance of hydrogen bonds in double helix of DN…
A: Deoxyribonucleic acid, or DNA, is a molecule that holds the information that allows an organism to…
Q: Match the label on the left with the correct structure number in the DNA molecule in the image…
A: The given structure is of a alpha helix DNA. The DNA is composed of nucleotides. Nucleotide - The…
Q: Discuss the differences between the Z-Form, A-form and B-form Dna
A: DNA (Deoxyribonucleic acid) is a molecule which is present in the nucleus of the cell. It contains…
Q: C-A-G-T-T-A-A-G-G-C-T-C-C-T-A-G-G-T-T-A 5' i. What would be the first 5 bases at the 3' end of the…
A: 3' C-A-G-T-T-A-A-G-G-C-T-C-C-T-A-G-G-T-T-A 5' Complementary strand- 5'- CTCAATTCCGAGGATCCAAT-3' i)…
Q: a. Write the structural formula of GAC, a portion of DNA. Write the complementary strand adjacent to…
A: Nucleotides are the building blocks of nucleic acids. Each nucleotide is composed of a nucleoside,…
Q: Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’…
A: Nucleus is main controller of the cell which carries genetic instructions . It contain Chromosome…
Q: If the sequence of bases on the one of the strand of a DNA molecule 5’ATTGCGGA - 3’ What is the…
A: DNA is a double helical structure composed of nucleotides.The two helices are joined together by…
Q: a. Write the structural formula of GAC, a portion of DNA. Write the complementary strand adjacent to…
A: Nucleotides are the building blocks of nucleic acids. Each nucleotide is composed of a nucleoside,…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the…
A: Deoxyribonucleic acid (DNA) is a molecule with two chains of polynucleotides that wrap around one…
Q: Draw the structure of the nucleotide represented by dTMP.
A: Nucleotides are organic molecules which is composed of a sugar moiety, a nitrogenous base, and a…
Q: polynucleotide strand has the bases G, T, C, and T, starting from the 5’ end. Assuming this is a DNA…
A: BASIC INFORMATION DNA It stands for deoxyribo nucleic acid. It is the genetic material of all…
Q: Describe the complementary, antiparallel, double-stranded structure of DNA.
A: DNA or Deoxyribonucleic acid is considered as the genetic material that contains all the hereditary…
Q: What is the melting temp. of the following double-stranded DNA fragment…
A: Melting temperature formula : Tm = 4* (G+C) + 2 * (A+T) Number of G+C = 6 Number of A+T = 20
Q: Which strand below would be the complementary strand for the sequence AAACGCTT O GGGTATCC O AAGCGTTT…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: The two strands of a DNA double helix can be separated by heating. If you raise the temperature of a…
A: A double-stranded DNA is joined together by a bond and seems to be a twisted ladder. Which is…
Q: Draw this stretch of DNA, showing BOTH strands, using a simplified model of a nucleotide as shown:…
A: DNA is the protein in all living organisms that convey genetic information.
Q: hat will be the order of amino acids derived from the following DNA sequence 5’-TGATCGCACAAT-3’?…
A: introduction
Q: b. What is the difference between the 3' and the 5' ends of a nucleotide chain? C. Do the chains run…
A: The double stranded helical structure of DNA (deoxyribonucleic acid) was first demonstrated by James…
Q: Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents…
A: Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) Sense strand is also known as…
Q: What does it mean to say that the DNA strands in a double helix have opposite directionality or…
A: DNA or Deoxyribonucleic Acid is the chemical name for the molecule carrying the genetic information…
Q: Examine the strand of DNA below. 3' CCTAGGCTGCAATCC5' 5'GGATCCGACGTTAGG3' An RNA primer is formed…
A: Here DNA templare strand is 3' - 5' . So RNA primer formed from 5' - 3' . Now primer sequence…
Q: Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and…
A: The complementary DNA sequence of DNA coding strand ATGATTATCCTATAG is TACTAATAGGATATC.
Q: If the sequence of base pairs on a DNA molecule are AGATTAGTG, what is the sequence on the…
A: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that coil around each…
Q: H H H.
A: The genetic material in all organisms is DNA where RNA is found in viruses as genetic material.…
Q: Explain, on the basis of nucleotide structure, why DNA synthesis proceeds in the 5’-to-3' direction.
A: The deoxyribonucleic acid (DNA) is known as a double helix structure in which two strands are joined…
Q: What does it mean when we say that the two DNA strands in thedouble helix are antiparallel? What…
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: The two strands of a DNA double helix can be separated by heating. if you raised the temperature of…
A: In the DNA strands, between every A-T base-pairing there are two hydrogen bonds present while In…
Q: If the DNA molecule read its complementary strand as: TACGATCCGAACCAAACT, how would the m-RNA read…
A: The synthesis of m RNA and t RNA from DNA is called transcription. Thre ribosomes synthesize…
Q: Give the sequence of the complementary DNA strand of the DNA chain with the following base sequence:…
A: Deoxy ribonucleic acid is the double-stranded hereditary material that consists of sugar,…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you identify important features - capitalization does not affect the nucleotide indicated. 5' ...atacaATGcATGTCAaCTAcg[a]agatccgTAGaTAACATtCATatc...3' a) Underneath that strand, write the sequence of the strand of DNA it would be paired with in a double-stranded helix. Use the single letter code A-adenosine, G-guanosine, T-thymine, C-cytosine, and U-uracil, and remember to label the 5' and 3' ends b) Next, write the sequence of a possible mRNA transcript of the double-stranded DNA above. Remember that an mRNA must be translatable by a ribosome into a protein. Be sure to indicate 5' and 3' ends c) Using the genetic code at the end, translate your mRNA into the appropriate protein. Write the amino acid sequence of the protein using the single letter amino acid code (also at the end) below the mRNA sequence in (b) and label the amino and carboxy terminals d) Suppose the bracketed bold [a] were…Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base sequences:(a) GGTTAC(b) CCCGAAWrite the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACAT
- For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandSuppose the following base sequence was found in a 20-base DNA polymer. 3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5' a. What would be the first 5 bases at the 3' end of the complementary strand? b. What would be the first 10 bases at the 5' end of the complementary strand? c. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair? with respect to the G-C base pair? d. In the given segment in problem 1, illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragmentThere is a chemically synthesized DNA oligonucleotide is 5’–AUCG–3’. Pleasedraw the all-atom structure of this RNA strand, including that of the phosphategroup, the pentose (ribose), and the base for each nucleotide. The structure is inthe 5’→3’ direction
- The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?To create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3', design the corresponding RNA sequence. Indicate the sequence in a 5' to 3' manner. What type of helix (A, B or Z) will this double-stranded nucleic acid form?(a) Write the DNA double strand. (b) Assuming the gel pattern represents the template strand, transcribe and translate the DNA. (c) Write the anticodon sequence. A G 2nd (middle) Base of a Codon 1* 3rd U A G Base Base UUU - Phe U UUC - Phe UCU - Ser UCC - Ser UAU - Tyr UAC - Tyr UGU - Cys UGC - Cys UUA - Leu UCA- Ser UAA - STOP UGA - STOP UUG -Leu CUU - Leu CUC - Leu UCG-Ser CCU - Pro CCC- Pro UAG- STOP CAU - His САC - His UGG- Trp CGU - Arg CGC - Arg CGA - Arg CGG- Arg CỦA - Leu ССА-Pro CAA - Gin CAG- Gin AAU - Asn CUG - Leu CCG-Pro AUU - Ile ACU - Thr АCC - Th ACA - Thr AGU – Ser A AGC - Ser AGA - Arg AGG - Arg GGU - Gly GGC - Gly GGA - Gly GGG - Gly AUC - lle AAC - Asn AAA - Lys AAG - Lys GAU - Asp GAC - Asp GAA - Glu AUA- lle AUG - Met ACG - Thr G GUU - Val GCU - Ala GCC - Ala GUC - Val GUA- Val GCA - Ala GUG - Val GCG - Ala GAG - Glu PUAGPCAGUCACUCAG |
- The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you identify important features – capitalization does not affect the nucleotide indicated. 5’…atacaATGcATGTCAaCTAcg[a]agatccgTAGaTAACATtCATatc…3’ a. Underneath that strand write the sequence of the strand of DNA it would be paired with in a doublestranded helix. Use the single letter code A-adenosine, G-guanosine, T-thymine, U-uracil and C-cytosine and remember to label the 5’ and 3’ ends. b. Next, write the sequence of a possible mRNA transcript of the double stranded DNA above. Remember that an mRNA must be translatable by a ribosome into a protein. Be sure to indicate 5’ and 3’ ends. c. Using the genetic code, translate your mRNA into the appropriate protein. Write the amino acid sequence of the protein below the mRNA sequence in (b) and label the amino and carboxy terminals d. Suppose the bracketed, bold [a] were mutated to be a t. Write the new sequence of your mRNA transcript…Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).