Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT TA 5' a. What would be the first 5 bases at the 3' end of the complementary strand? b. What would be the first 10 bases at the 5' of the complementary strand?

Q: Below is a sample of a segment of DNA…(copy from left to right)   3’…

A: Mutation  It occurs when a DNA gene is changed in such a way as to alter the genetic message carried…

Q: Base nitroɡen DNA pair which are have 2 bond of H₂ inside of them?

A: A nucleotide is formed by nitrogenous base, sugar and phosphate. DNA is made up of polymer of…

Q: Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules,…

A: DNA (Deoxyribonucleic acid) and RNA (Ribonucleic acid) are two examples of nucleic acids. DNA and…

Q: Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: Assume the energy of hydrogen bonds per base pair to be 5.86 kJ-mol-1. Given two complementary…

A: Given Energy of H-Bond per base pair = 5.86 kJ mol-1 Number of Base pair in complementary DNA = 145…

Q: In the Watson-Crick model of DNA structure:   Question 5 options:   T can form three hydrogen…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: You will start off by laying out your individual nucleotides for the first strand using the…

A: DNA is a macro molecule or a polymer which is made up of a monomer called nucleotides. Each…

Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…

A: Introduction DNA is the molecular structure that is composed of a pair of polynucleotide chains…

Q: Once the nucleotide in the picture is added to the 3’end of growing strands, DNA synthesis is…

A: Introduction: DNA molecule end  has a number. One end is referred to as the 5' (five prime) and…

Q: What does it mean to say thhat extension by DNA polymerase III proceed 5'---3'?  A. The 5' end of a…

A: 5' end or five prime end is the end of DNA or RNA strand and has the fifth carbon in sugar ring of…

Q: onsidering the number of base pairs, compute for the actual length (in micrometers) of this DN

A: There are 7 base pairs. Length of one base pair is 3.4 Angstrom. Length of  7 base pairs is 3.4 X 7=…

Q: Out of the 4 base pairs that are shown, B and C are the ONLY Watson-Crick base pairs that are found…

A: The four bases that make up DNA are adenine (A), cytosine (C), guanine (G), and thymine (T), while…

Q: Consider a portion of double-stranded DNA with the complementary sequence of base pairs shown. Write…

A: DNA is genetic material in most of living organisms. There are four nitrogenous  bases present in…

Q: The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you…

A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: The complementary strands of DNA in the double helixare held together by hydrogen bonds: G ≡ C or A…

A: DNA double helix is formed by the hydrogen bonds formed between the base pairs. Adenines forms two…

Q: phosphodiester bonds 8 0-2-0-3 O HCS H₂C 8-6-0 H₂C OH O 0-6-0 H₂C OH O 2 purine pyrimidine T Strand…

A: DNA (Deoxyribonucleic Acid) is a double-stranded structure that carries the genetic instructions of…

Q: Draw the following strands of DNA 5’ C-A-T 3’ as well as the complementary base pairing strand…

A: Two strands of DNA twist around one another to form a double helix DNA and both are in anti-parallel…

Q: Draw the following structure. 1)A single strand of DNA with the sequence 5' GCAT 3'

A: Sure, here's a simple representation of a single strand of DNA with the sequence 5' GCAT 3':   5'  G…

Q: (a) (b) (c) The figure shown below is the mechanism of a DNA nuclease. The DNA molecule is in blue…

A: The given figure shows the mechanism of a DNA nuclease. Nucleases breaks the phosphodiester bonds of…

Q: I need help because i don't get it. Can you help me to explain to me, please?

A: DNA It refers to the molecule that constitutes genetic information that is passed from generation ot…

Q: Using the following coding DNA sequence:TAC GCA CCT TTA GAT CAT AAC TTT GGA ACT1. Write the…

A: Deoxyribose nucleic acid (DNA) is the genetic material composed of four nucleotide bases, namely…

Q: What is true of this figure? (can be multiple answers) a. the replication fork is asymmetrical b.…

A: DNA is the genetic material of an organism. DNA replication is a process in which two DNA molecules…

Q: ’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and…

A: Watson and Crick elucidated in 1953 , the famous double stranded structure of the DNA molecule and…

Q: If the DNA that is about to be replicated has the following sequence: 5' ATTGCACTTAGGAATT 3' 3'…

A: INTRODUCTION The genetic material contained in all living things is called DNA.It is a…

Q: Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends:…

A: DNA is the molecule found inside cells that carries the genetic data required for an organism's…

Q: H Н Н H

A: A tetranucleotide is a DNA fragment sequence having four bases. The answers to the question are…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Given DNA strand:  5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'

Q: On paper, replicate the following segment of DNA:            5’ A T C G G C T A C G T T C A C 3’…

A: DNA replication is a complex process of producing copies of the entire chromosome using the…

Q: elow is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA…

A: Without the enzymes, DNA replication is incomplete. The initiation, elongation, termination, and…

Q: most likely 11 nucleotides on this strand that serve as the replication origin

A: According to Chargaff's rules of base pairing stoichiometric ratio of purine and pyrimidine bases…

Q: The Sanger products in the sequencing of a template DNA is shown below: +ddTTP +ddATP +ddCTP +ddGTP…

A: Sanger method of DNA sequencing is a chain termination method of DNA sequencing in which…

Q: Using the numbered sites on the DNA double helix strands below, where would the DNA Primer ACTTGCGA…

A: Primers are short stretches of DNA that target unique sequences and help identify a unique part of…

Q: Label the following graph, which indicates the temperature versus the percent of DNA that is single…

A: DNA The genetic material of organisms reside in the nucleus of the cell. It carry genetic…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.