Given that a faulty ribosomal protein is the culprit and causes DBA, discuss the possible role of normal ribosomal proteins. Why might bone marrow cells be more susceptible to such a mutation than other cells?
Q: What is the resulting polypeptide: _______________________________________________________? What…
A: Mutation in a gene sequence causes encoding of a mutated protein. This mutated protein will have…
Q: As part of a project investigating potential new drug targets in the fight against malaria, you are…
A: Introduction:- Truncation of protein:- is meant by the proteolysis or structural gene manipulation…
Q: Trichothiodystrophy is a human inherited disorder characterized by premature aging, including…
A: Trichothiodystrophy is a rare, autosomal recessive disease which is characterized by brittle sulfur…
Q: How is the production of particular proteins limited to certain cell types at certain times,…
A: Fertilization of an egg cell by a sperm results in the formation of a zygote. The zygote undergoes…
Q: What does the chipko andolan resulted to?
A: Chipko movement is also known as Chipko Andolan. It was launched to conserve forest in India. It was…
Q: Why do adult human cells (other than germ cells and stem cells) NOT express the enzyme telomerase?…
A: Telomerase expression is required for cell immortalization ( in cancer cells) and long term tumour…
Q: Why are misfolded proteins a potential problem for the eukaryotic cell, and how do cells combat the…
A: Eukaryotic cells can be defined as the cells that are complex in terms of structure and function as…
Q: le) Frrors may occur during DNA replication, resulting in a change to the sequence of base triplets.…
A: Through the replication process, the information from one DNA molecule is replicated to create two…
Q: Why might some cells in the body, such as those in bonemarrow, be more susceptible to ribosomal…
A: Mutation It is the sudden heritable changes happening in the genotype of the organism which is…
Q: How did the back mutation in hisG affect the protein produced by this gene?
A: Back mutation or backward mutation is a kind of mutation which leads to reversion of the mutated…
Q: What two reaction steps are required for the formation of an aminoacyl-tRNA?
A: In molecular biology, translation is the cycle wherein ribosomes in the cytoplasm or endoplasmic…
Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…
A: A mutation is a change that occurs in our DNA sequence, which might occur due to mistakes when the…
Q: What is single-cell protein? Explain the reasons for the removal or reduction of nucleic acid in…
A: Protein is a substance formed of amino acids joined by peptide bonds. Nucleic acid - are compounds…
Q: A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to…
A: Mutations are abrupt changes in DNA only one ways has been changed the original DNA.
Q: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…
A: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…
Q: Why is the term “proteome” ambiguous, whereas the term“genome” is not?
A: The proteins are the essential part of living organisms and it consists of thousands of smaller…
Q: Are tRNAfmet and tRNAmet made from the same aminoacyl tRNA synthetase?
A: Amino acyl tRNA synthase pairs tRNA with amino acid that their anti codon codes for. Amino acyl tRNA…
Q: In the: Inhibition of splicing by ribozymes Explain: (a) What is the process affected? (b) What is…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: The protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb.…
A: Because the gene contains introns (non-coding regions within the gene) that are removed during the…
Q: The protein Xpot transports tRNAs out of the nucleus so that they can be aminoacylated in the…
A: tRNA or transfer RNA is the RNA molecule that attaches to an amino acid as per the anticodon…
Q: Can someone give me a few inherited disorders that are NOT caused by mutations? and if possible,…
A: Tay Sachs disease- Children's with the tay Sachs disease appears healthy at birth but becomes…
Q: What are some limitations in the use of ASOs for exon-skipping therapies in Duchenne muscular…
A: Duchenne Muscular Dystrophy (DMD) is a muscular disease caused by mutations in the dystrophin gene…
Q: What are the three functional parts of the tRNA and what is their importance to translation?
A: Transfer RNA or tRNA generally contains 76-90 nucleotides and acts as a physical link in between…
Q: Identify the Mutations 1. Original Strand Mutant Strand GGGCTAGGGCCAA GGGGCTAGGGCCAA Types of…
A: Mutations are the gradual changes that occur in our DNA sequence because of several factors such as…
Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…
A: A gene mutation is a permanent alteration that makes up a gene in the DNA sequence, so that the…
Q: Explain what would not occur if aminoacyl-tRNA synthatase was mutated and did not function.
A: tRNA or transfer RNA is the carrier RNA which acts as cargo to pick up the proper anticodons for the…
Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…
A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…
Q: Figure shows a part of the sequence alignment of human and whale myoglobin proteins. Please explain…
A: The condition represented in the sequence alignment is amino acid replacement. In amino-acid…
Q: Cytosine
A: Introduction :- A mutation occurs when a DNA gene is damaged or changed in such a way as to alter…
Q: Once the chains of peptides that make up lysyl-tRNA synthetase protein are synthesized in ribosomes,…
A: Protein folding is the process where the proteins fold themselves to come to their native form. This…
Q: Which of the given disorder can be seen in an individual when the mutation includes substitution of…
A: Purines and pyrimidines are nitrogenous bases present in nucleic acids. Substitution of purine by…
Q: What is Barchyury protein? What is the structural aspects of DNA binding of Barchyury?
A: In 1927 brachyury mutation was first described in mice by adezhda Alexandrovna…
Q: Why is folding in the ER slow and inefficient and how are the misfolded ones degraded?
A: Endoplasmic reticulum-associated degradation (ERAD) is the QC check point of the ER which helps to…
Q: • Description of Phenylketonuria • Explanation of what causes Phenylketonuria • Explanation of the…
A: A) Phenylketonuria additionally called PKU, is an uncommon acquired disorder that makes an amino…
Q: In Cystic Fibrosis, what are the normal and mutated protein function
A: Cystic fibrosis is an autosomal recessive genetic disorder which affects the lungs and also the…
Q: what is the anticodon sequence that would build this protein?
A: The process of formation of mRNA sequence from a DNA transcript is known as translation. In mRNA,…
Q: Two possible point mutations are the substitution of lysine for leucine or the substitution of…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense…
A: A missense mutation causes change in a single nucleotide. The resultant codon codes for an amino…
Q: I only need letter D
A: Deoxy ribonucleic acid (DNA) is the genetic material that contains genetic material in the form of…
Q: Consider the expression “central dogma,” which refers to the flow of genetic information from DNA to…
A: The transfer of genetic data in cells from DNA to messenger RNA (mRNA) to protein is described by…
Q: A mutant strain of bacteria is isolated in which the amino acid glutamine is often erroneously…
A: Answer of the question given below...
Q: Which of these mutations would you predict to be most detrimental? Explain your answer. (Refer to…
A:
Q: Is the Aminoacyl tRNA synthetases in human cells specialized or non specialized? Explain.
A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…
Q: What is the role of folate in pyrimidine synthesis and what is the consequence of a folate…
A: Folate is a kind of vitamin B. It is also known as vitamin B9. It is usually taken in the form of…
Q: Using sickle-cell anemia as an example, describe what is meant by a molecular or genetic disease.…
A: Sickle-cell anemia is an autosomal recessive trait. The disease is controlled by a single pair of…
Q: How many base pairs are changed in the sickle cell mutation?
A: in sickle-cell anemia, the gene for beta globin is mutated. As a result the mutated protein is…
Q: What are the major differences between one-stepand two-step translocases? Which are used to…
A: Bacteria are microorganism that most commonly occur in the soil, air, water and in extreme…
- Given that a faulty ribosomal protein is the culprit and causes DBA, discuss the possible role of normal ribosomal proteins. Why might bone marrow cells be more susceptible to such a mutation than other cells?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- For the following diseases, describe the best technique for diagnosing them. Please make sure you include how you would tell someone with the disease from someone without the disease. B. Factor V Leiden thrombophilia is caused by a point mutation at position 1691 in exon 10 of the Factor V clotting factor gene that changes an arginine into a glutamine. This change removes one of the cleavage sites for activated protein C and leads to an increased tendency to clot.In Cystic Fibrosis, what are the normal and mutated protein function?Why might some cells in the body, such as those in bonemarrow, be more susceptible to ribosomal protein mutations than other cell types?
- Describe the mutational event that produces the MYC oncogene in Burkitt’s lymphoma. Why does the particular mechanism for generating oncogenic MYC result in a lymphoma rather than another type of cancer? Describe another mechanism for generating oncogenic MYC.Explain the term hematopoietic growth factors (HGFs)?What type of mutation is sickle cell anemia? Explain the molecular basis of sickle cell anemia.
- RG, a 6-year-old child, has been diagnosed with Acute Lymphoblastic Leukemia (ALL). The standard treatment is 6-mercaptopurine (Purinethol), an inexpensive drug that inhibits proliferation and is effective against rapidly proliferating cells like cancer cells. The compound is an antimetabolite that interferes with DNA synthesis. However, about 10% of patients experience life-threatening toxicities. 6-mercaptopurine is metabolized and detoxified by the enzyme thiopurine-S-methyltransferase (TPMT). The most common SNPS correlated with low enzymatic activity are TPMT*3A, *3B, *3C and *2. They cause enhanced degradation of the enzyme. Genotyping reveals that RG has the following genotype: TPMT*3A/*2. Questions: 1. A patient with low TPMT enzyme activity would: Accumulate 6-mercaptopurine and experience toxic side effects Metabolize 6-mercaptopurine quickly and experience no anti-cancer benefits 2. The gene encoding TPMT has been sequenced in RG: TPMT*3A/*2. The patient would be classified…RG, a 6-year-old child, has been diagnosed with Acute Lymphoblastic Leukemia (ALL). The standard treatment is 6-mercaptopurine (Purinethol), an inexpensive drug that inhibits proliferation and is effective against rapidly proliferating cells like cancer cells. The compound is an antimetabolite that interferes with DNA synthesis. However, about 10% of patients experience life-threatening toxicities. 6-mercaptopurine is metabolized and detoxified by the enzyme thiopurine-S-methyltransferase (TPMT). The most common SNPS correlated with low enzymatic activity are TPMT*3A, *3B, *3C and *2. They cause enhanced degradation of the enzyme. Genotyping reveals that RG has the following genotype: TPMT*3A/*2. Questions: A patient with TPMT*l/*1 should receive what kind of dose? Reduced dose Standard dose Increased doseLi- Fraumeni Syndrome (LFS) is a rare hereditary cancer disease due to a mutation in the TP53 gene. Propose a treatment strategy for LFS.
- Hurler syndrome is due to a mutation in a gene that encodes aprotein called α-l-iduronidase. This protein functions withinlysosomes as an enzyme that breaks down mucopolysaccharides(a type of polysaccharide that has many acidic groups attached).When this enzyme is defective, excessive amounts of the mucopolysaccharides dermatan sulfate and heparin sulfate accumulatewithin the lysosomes, especially in liver cells and connectivetissue cells. This accumulation leads to symptoms such as anenlarged liver and spleen, bone abnormalities, corneal clouding,heart problems, and severe neurological problems. The pedigreebelow contains three members affected with Hurler syndrome,indicated with black symbols. Based on this pedigree, does thissyndrome appear to follow autosomal recessive, autosomaldominant, X-linked recessive, or X-linked dominant inheritance?Explain your reasoning.Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?Which of the given disorder can be seen in an individual when the mutation includes substitution of a purine by pyrimidine? 1. Chronic myelogenous leukemia 2. Sickle cell anaemia 3. a thalassemia 4. B thalassemia