What is the resulting polypeptide: _______________________________________________________? What effect does this mutation have on the polypeptide? Make sure to compare to the original polypeptide. Would this mutation allow the protein for perform the intended function? Why or why not?

Q: I have a presentation on the discovery of the genetic code, but I don't know how to organize my…

A: Presentation should start with a brief introduction about the genetic code. It should cover the most…

Q: What does the chipko andolan resulted to?

A: Chipko movement is also known as Chipko Andolan. It was launched to conserve forest in India. It was…

Q: How are ribosomes affected in treacher Collins Syndrome disorder? Please write it in a…

A: Treacher Collins syndrome (TCS) is a genetic disorder which is characterized by deformities of the…

Q: 1. Does protein synthesis begin with the N-terminal or with the C-terminal amino acid? 2. What is…

A: The translation is the process of synthesis of a polypeptide chain or protein from an mRNA molecule.…

Q: Sickle cell hemoglobin DNA CACG T AGACTGAGGA CAC Sickle cell hemoglobin MRNA ickle cell hemoglobin…

A: According to the question, we have to mention the type of mutation present in Sickle cell anemia…

Q: In the text box below, answer the following questions. Remember to label your answers that…

A: Transcription  The process by which DNA is transcribed as mRNA from which polypeptide chain is made.

Q: Which isomer- (R)-arginine or (S)-arginine is D-arginine? O (R)-arginine O (S)-arginine Submit…

A: Isomers are molecules with same molecular formula and different arrangement of atoms. Enantiomers…

Q: Describe instances when a DNA mutation would not alter the function of a protein. Describe instances…

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: Refer to the partial gene sequence of DNA nucleotide bases listed below, and the genetic code chart…

A: The series of mechanism by which a DNA sequence is is transcribed into RNA, and mRNA is translated…

Q: How can ribosomes cause problems in treacher collins Syndrome? Please write it in a…

A: Treacher collin syndrome is defined as the state of genetic disorder in which the facial bones are…

Q: What does SERMs stand for?

A: Ans: SERM: The term SERM stands for Selective estrogen receptor modulators.

Q: This question refers to the mRNA sequence below: 5'-AGCUGAUGGGCUGGUGCCGAGAAAGUUAGGUAA-3' What is the…

A: During translation, the mRNA is read in triplets. The incoming tRNA reads the three bases at a time…

Q: what is protein sorting ?

A: Protein sorting is the mechanism by which the proteins are transported to their appropriate location…

Q: How many nucleotides would be necessary to code for 10 amino acids? Please help, I am lost!

A: Introduction :- DNA and RNA are made up of nucleotides, which are the basic building blocks of both.…

Q: A mRNA contains a codon with the sequence 5'-UAC-3'. What would be the most likely sequence of the…

A: tRNA read out m-RNA and synthesize polypeptide chain with the help of ribosome.

Q: How ribosomes causes problems in treacher Collins Syndrome disorder? Please write it in a…

A: Treacher Collins syndrome is a genetic disorder that most often affects the cheek bones, jaw, chin…

Q: What is the peptide bond formation? Please do not plagiarize from the internet and provide your…

A: A peptide bond is a bond formed between the α-nitrogen atom of one amino acid and the carbonyl…

Q: A portion of an unknown enzyme has the amino acid sequence serine – phenylalanine – glutamate –…

A: In Central dogma, DNA is converted into RNA through the process of transcription and RNA is…

Q: Give the amino acid sequence with some little explanation please.   5′…

A: Decoding a sequence of bases in mRNA results in the formation of either peptide, polypeptide, or…

Q: How do you translate this into amino acid sequence

A: The process of synthesis of protein with the help of messenger RNA is called translation. In the…

Q: ALL GROUPS HAVE A MUTATION MAKE SURE TO IDENTIFY THEM**

A: A mutation is a change in a DNA sequence. It can result from DNA copying errors made during cell…

Q: Sequence: AAA UGG CAA Translate the sequence into the correct amino acids.   Question 2 options:…

A:

Q: If the mRNA molecule from your answer to the previous question is going to be translated into a…

A: The gene is the portion of DNA that codes for a specific protein. First, the DNA is converted to…

Q: * Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG…

A: Anticodons are nucleotide sequences that are the opposite of codons. They're located in tRNAs, and…

Q: First Second Letter Third Letter U A G Letter phenylalanine phenylalanine serine tyrosine cysteine U…

A: Gene is present in the DNA. It is made up of sequence of nucleotides. It encodes a protein.

Q: What are the Okazaki fragments?

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: Please draw or send me a picture of the structure of DNA and label the parts. Thank you very much.

A: Deoxyribonucleic acid: DNA is a genetic material that is present within the nucleus. It was…

Q: Would love a list of different types of nucleotide repeat disorders.

A: Nucleotide is a chemical structure which constitute together to form the genetic structure that is…

Q: • Description of Phenylketonuria  • Explanation of what causes Phenylketonuria  • Explanation of the…

A: A) Phenylketonuria additionally called PKU, is an uncommon acquired disorder that makes an amino…

Q: In Cystic Fibrosis, what are the normal and mutated protein function

A: Cystic fibrosis is an autosomal recessive genetic disorder which affects the lungs and also the…

Q: Number er & Footer Time Info Parts Insert Pictures Header Footer Link to Previous Navigation Show…

A: Introduction  The word used to identify the DNA nucleotide bases make up the whole term "Gattaca."…

Q: 1. A nucleoside is composed of Sugar and Nucleic Acid-Base. 2. The Nucleic Acid base in DNA and RNA…

A: Answers are given below,

Q: what is the anticodon sequence that would build this protein?

A: The process of formation of mRNA sequence from a DNA transcript is known as translation. In mRNA,…

Q: Using the codon charts in your text (section 6.1), fill in the chart below. [  /8]   Original DNA…

A: The gene expression in the cells is brought about by the various processes of Replication…

Q: This question refers to the mRNA sequence below: 5'-CCGUAUGCAUUUCGGACUUAGUAAGGACUGACAUAA-3' What is…

A: Question - This question refers to the mRNA sequence below: 5-CCGUAUGCAUUUCGGACUUAGUA…

Q: This question refers to the mRNA sequence below: 5'-CCGUAUGCAUUUC GGACUUAGUAAGGACUGACAUA A-3' As…

A: The mRNA is produced from the DNA template strand by the transcription process. This mRNA contain…

Q: 1.  Partner DNA strand 2. the mRNA strand 3. The tRNA  4. the formed amino acids  5. the…

A: Given:    3’   T   A  C   A   T   G   C   C   G   A   A   T   G   C   C   5’ To find: 1.  Partner…

Q: T-A-C |А - А - G А - т-G G-G-G А -т-т DNA enter answer - enter answer enter answer - enter answer…

A: DNA mRNA TAC AUG AAG UUC ATG UAC GGG CCC ATT UAA

Q: What is the expansion of acronym MICA?

A: Immune system includes cells and molecules involved in protecting body against antigens.

Q: Describe why this position in your protein is important and outline the effects the mutation will…

A: Any change in DNA is referred to as a mutation. Any heritable and genetic modification in the genome…

Q: what does the Hexa protein domain depict? (in relation with tay sachs disease)

A: Beta-hexoaminidase A is an enzyme that is present in the lysozyme. It breaks down a fatty substance…

Q: What will be the amino acid sequence?

A: Each protein or peptide consists of a linear sequence of amino acids. The protein primary structure…

Q: Discuss the potential difficulties of designing a diet to alleviate the symptoms of phenylketonuria.

A: Phenylketonuria is an inborn, autosomal recessive disorder that effects metabolism. The individuals…

Q: Please help me answer the TRANSLATION AND PROTEIB SYNTHESIS 1. Beginning with DNA, describe in…

A: Protein is synthesized via translation of mRNA template by ribosomes in the cytoplasm. mRNA has…

Q: Why is a Dichotomous Key considered arbitrary

A: Introduction The word "dichotomous" refers to splitting into two parts.  A dichotomous key is a tool…

Q: What is the meaning of the statement “The code is redundant but not ambiguous?”.

A: Base-pair substitution, deletion, or addition constitutes a mutation in a gene. The effect of such…

Q: What is the resulting polypeptide: _______________________________________________________? What…

A: Biomolecules are organic molecules present in living organisms. They include carbohydrates,…

Essential nutrients

These are the organic compounds present in the food that provide nourishment essential for the development and growth of our body. Nutrients not only provide us with the required energy to carry out various biological processes but are also the building blocks for repair and growth in our bodies.

Vitamins

The vitamins are organic molecules required in low concentration for the proper functioning of the body. They cannot be generated in the organism and are taken into the body through the diet. The lack of proper vitamins results in diverse deficiency disorders. They are thus called essential nutrients. The important vitamins are vitamin A, vitamin B complex, vitamin C, vitamin D, vitamin K, and vitamin E.