For the following DNA sequence TAC-CCC-AAA-TTT-ATC Write: the mRNA codons the tRNA anticodons the protein formed
Q: DNA DNA Complimentary MRNA sequence tRNA sequence Amino acid code Strand А T A А А G T А T T T A G
A: Assuming the given sequence is sense strand of the DNA. The sense strand is in the direction 5’-3’.…
Q: AAAC G CA G CCG Phe Gly Arg
A: In this image, we are shown the formation of proteins from DNA by following the central dogma of…
Q: The genetic code is defined as a series of _______________ in _______________. (a) anticodons;…
A: The genetic code, anticodons, codons, mRNA, and tRNA are all involved in the expression of a gene. A…
Q: Order of Order of Order of Amino Acid bases bases in MRNA | (codon) bases Coded into in DNA in TRNA…
A: As we know DNA contains A T G C Bases and RNA Contains A U G C Bases. mRNA is complementary to DNA…
Q: If the DNA sequence is ATG-CGT, the mRNA codons are ___. ATG-CGT UAC-GCA GUA-CGU AUG-CGU…
A: DNA full form is deoxyribonucleic acid. DNA is the main constituent of the chromosome. It contains…
Q: DNA G C A strand DNA TA C TA C strand MRNA A U G U G codon TRNA anticod G on Amino Tryptoph Stop…
A: DNA is deoxyribonucleic acid which acts as a source of genetic material inside living organisms. DNA…
Q: Which category of RNA carries amino acids for the process of translation? rRNA snRNA mRNA tRNA
A: Translation is the process of Synthesis of proteins from mrna. This process takes place in cytoplasm…
Q: If a tRNA molecule has an anticodon which reads AUG what was the codon of the mRNA MOLECULE
A: tRNA is also called a transfer RNA. It is a secondary structure of RNA having stem loops. It is a…
Q: A certain mRNA strand has the following nucleotide sequence: 5'—AUG—ACG—UAU—AAC—UUU—3' What is the…
A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…
Q: What enzyme is responsible for forming peptide bonds between amino acids? Aminoacyl-tRNA synthetase.…
A: Translation is the process of synthesis of protein in the cytoplasm.
Q: The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT Give the mRNA…
A: Answer: CENTRAL DOGMA : It is the complete process of replication of DNA , transcription of DNA and…
Q: The codon sequence corresponds most closely to the sequence of the strand. MRNA O coding DNA TRNA O…
A: Most cells contain deoxyribonucleic acid (DNA) as their genetic material. Some also have ribonucleic…
Q: A section of an mRNA has the following nucleotide sequence: ACU UGC AGU GGU GUA For the mRNA…
A:
Q: State one role for each of the following molecules in the process of protein synthesis. DNA: MRNA:…
A: Proteins are complex macromolecules that are involved in different body functions. They are produced…
Q: The three-nucleotide codon system can be arranged into ____________ combinations.a. 16b. 20c. 64d.…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. Nucleotides are…
Q: Amino acids Codon MRNA Ribosome TRNA
A: Introduction : Translation is an important process of the central dogma. The DNA or deoxyribonucleic…
Q: Which of the following are involved in transcription? O RNA polymerase DNA amino acids TRNA acetyl…
A: In translation mRNA, tRNA, rRNA, Amino acids, ribosome, acetyl transferase are required.
Q: Anticodons pair with_____ . a. mRNA codons c. RNA anticodons b. DNA codons d. amino acids
A: Translation is the process by which proteins are formed in the cytoplasm using ribosomes and mRNA.…
Q: Which of the following statements is TRUE? O DNA polymerase moves in a 5 to 3 direction in…
A: In this question, we have to identify the statement that is true.
Q: How many nucleotides are in 12 mRNA codons? a. 12 b. 24 c. 36 d. 48
A: The three-letter nature of codons means that the four nucleotides found in mRNA are A, U, G, and C.
Q: Which of the following MRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…
A: The mRNA is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene.…
Q: A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1.…
A: Translation or protein synthesis is the third major step of the central dogma of life. mRNA…
Q: The genetic code is made of 3 RNA nucleotides read 3-->5' 3 RNA nucleotides read 5'-->3' 3 DNA…
A: In molecular biology, the central dogma controls the process of transcription in which DNA is…
Q: polypeptide peptide bond +amino acid tRNA codon anticodon UCA GCA CGU UGC GU ACG UCA ribosome MRNA
A: Translation is the process of formation of a sequence of amino acids using mRNA as a template. It…
Q: An anti-codon is on what kind of molecule? O DNA O TRNA O polypeptide O MRNA
A: An anticodon is a tri-nucleotide sequence which is complementary to the codon sequence present on…
Q: Table 8.2: Transcription and translation of the first 7 codons in the B-globin chain of hemoglobin.…
A: Change in the DNA sequence can causes alternation of the amino acid sequence. This can causes an…
Q: Which of the following have codons? amino acids acetyl transferase FRNA RNA polymerase proteins TRNA…
A: The DNA is the genetic material of the living organisms like humans. This molecule carries the…
Q: A codon is a. one of three nucleotides that encode an amino acid. b. three nucleotides that encode…
A: DNA is transcribed into mRNA. mRNA has codons which are translated into amino acids. Every codon…
Q: Amino Acids coded Order of Bases in DNA Order of Bases in Order of Bases in MRNA (codon) TRNA…
A: According to central dogma of molecular biology :- I ) DNA consists of two strand : coding and…
Q: A small section of mRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids…
A: mRNA is a ribonucleotide sequence produced as a result of transcription from DNA. Once the mRNA is…
Q: DNA Sequence mRNA Sequence (codon) tRNA Sequence {anticodon) AMINO ACID Sequence
A: Introduction DNA (Deoxyribonucleic acid)serves as the genetic material of almost all organisms (some…
Q: Drag and drop the following terms into the correct spots on the image below. 1. Amino Acids 2.…
A: Ribosomes are responsible for the production of proteins. They accomplish this through a process…
Q: Write corresponding mRNA code and the amino acid acid sequence for the DNA segment with the…
A: Transcription is a process of formation of transcript or RNA from DNA by the process of…
Q: The “start” codon is ____ - ____ - ______
A:
Q: The codon on the ________ matches with the anticodon on the ________ to direct the addition of the…
A: Codon are the triple of a base pair.
Q: The following sequence represents triplets on DNA:TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA…
A: Hello, thank you for your question. The second part of the question seems to be incomplete,…
Q: If instead of 20 amino acids there were 200 amino acids, then how many nucleotides would you be…
A: An mRNA directs the insertion of single amino acid to a protein per three nucleotides. A codon is a…
Q: If the codon for Histidine is 5' CAU 3' in an MRNA molecule, the anticodon on the TRNA is: UAC ATG…
A: In every group of messenger ribonucleic acid (mRNA), there are three bases. A codon is also there…
Q: Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…
A: The central dogma involves two processes to bring about gene expression, namely transcription, and…
Q: DNA = CGC AAA CTA AGC TAC ACT AGC GTT TTA ATT MRNA = tRNA = KINDS OF PROTINE;
A: The glide of statistics from DNA to RNA to proteins is one of the fundamental principles of…
Q: Which of the following does not code for an enzyme having both helicase and nuclease activity?a)…
A: Genetic recombination is the exchange of genetic material between different organisms which leads to…
Q: This single stranded nucleic acid has anti codons TRNA MRNA. FRNA. DNA. glucose OOO
A: "Nucleic acid" is a term we use to describe certain large molecules in a cell. So they are actually…
Q: Which of the following choices best match the blank? Three-nucleotide segments of RNA called…
A: Amino acids are the monomers or structural units that are responsible for protein formation. The…
Q: DNA DNA Complimentary MRNA sequence tRNA sequence Amino acid code Strand A т G А A A G T А T т T А G
A: Gene expression is the process by which the information from a gene is used in the synthesis of a…
Q: Which of these features is found in eukaryotes but not bacteria?a. polygene mRNAs b. introns c. stop…
A: Living organisms are primarily classified as prokaryotes and eukaryotes. Prokaryotic organisms like…
Q: the DNA triplet is TTA, then the transcribed mRNA codon would be
A: There are four nucleotides from which DNA and m RNA are made- Adenine -A Thymine- T/ U- uracil…
Q: If the following were part of a DNA chain, what mRNA bases would pair with it to transcribe the DNA…
A: INTRODUCTION The carrier of genetic information within a cell is DNA, which stands for…
Q: during translation, each codon on the mRNA complementary base pairs with an snticodon on.....
A: Translation is the process in which proteins are synthesized by ribosomes.Translation occurs after…
Q: Which of the following molecular structures contan codons? a protein B mRNA C. IRNA D. rRNA and C
A: The genetic material contains the genetic information. It passes the information from parents to…
Q: DNA T A G strand DNA G G strand MRNA codon U TRNA anticodon A Amino acid Alanine Glutamate
A: Genomic DNA contains information about the genes. DNA is a double-stranded molecule composed of two…
For the following DNA sequence
TAC-CCC-AAA-TTT-ATC
Write:
the mRNA codons
the tRNA anticodons
the protein formed
Trending now
This is a popular solution!
Step by step
Solved in 4 steps with 4 images
- Complete the complementary strand: mRNA transcription ATTCGAGGCTAAmRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letter
- (ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCTIf DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- G
- If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- GA segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'.
- SPLIT DNA MRNA TRNA Codon Anticodon Amino Acid A T C A T T A T C T A G ASuppose that a protein has the amino acid sequence Met‑Tyr‑Asn‑Val‑Arg‑Val‑Tyr‑Lys‑Ala‑Lys‑Trp‑Leu‑Ile‑His‑Thr‑Pro A researcher plans to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Her probes should be exactly 18 nucleotides in length. Consult the codon table. Select which amino acids in the protein should be used to minimize degeneracy when designing the probes. Val‑Tyr‑Lys‑Ala‑Lys‑Trp Met‑Tyr‑Asn‑Val‑Arg‑Val Arg‑Val‑Tyr‑Lys‑Ala‑Ly Trp‑Leu‑Ile‑His‑Thr‑Pro Calculate the number of different probes that must be synthesized in order to determine the exact cDNA sequence that specifies the region of the protein selected. number of probes:w/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdf