Find a genetically modified organism of interest. What organism is the origin of the coding sequence? What is the product of this recombinant gene? What is the commercial interest in this GMO? What are the ethical concerns with GMOs?
Q: What is your understanding of the contributions of Copernicus, Darwin and Freud to modern society?
A: Copernicus, Darwin and Freud all three of them are related to the philosophy of science and revoluti...
Q: Please help me with this.. What is the general consideration in the use Genetically Modified Fish fo...
A: Genetic engineering is a type of technology in which various genes that impart benefits to a partic...
Q: Pressure being applied by the cell wall would make the water (more likely/less likely) to want water...
A: Solute potential or ormotic potential is the pressure which is needed to be applied on a solution to...
Q: What issues do you think may happen with our immune systems and the production of the next generatio...
A: The concept that pregnancy is associated with immune suppression has created a myth of pregnancy as...
Q: Why some dominant mutant alleles are antimorphic
A: Mutations are modifications or alterations that occur in deoxyribonucleic acid (DNA). Mutagens are t...
Q: Briefly, in your own words, describe the steps of the gram staining procedure.
A: The bacterial kingdom is classified into Gram positive and Gram negative bacteria depending on their...
Q: Draw and describe the similarities and differences between facilitated diffusion and active transpor...
A: Movement of molecules is one of the vital process in an organic life. This movement is an ever going...
Q: . What kinds of molecules pass through a cell membrane most easily?
A: The Cell Membrane: The cell membrane, also known as the plasma membrane, is found in almost all cell...
Q: Part A) How does the molecular mechanism of elongation arrest by SRP differ between Bacillus and Mam...
A: Introduction: The SRP targeting mechanism's co-translational nature is most likely to blame for its...
Q: 3) List and define the organizational structure of skeletal muscle beginning with the sacrcomere up ...
A: Skeletal muscles make up the most part of our muscles. They account for around 30 to 40 percent of o...
Q: Activity 2.2: The Hormonal Actions During Menstrual Cycle Directions: Complete the flow chart by cho...
A: Introduction :- Menstruation is the monthly shedding of a woman's uterine lining (more commonly know...
Q: Radiation is the emission and propagation of high speed electrons in an x-ray tube in the form of wa...
A: Introduction X-rays are a type of radiation called electromagnetic waves. X-ray imaging creates pict...
Q: Describe error prone polymerases and the process of translesion synthesis (TLS). In regards to tumor...
A: Translesion synthesis (TLS) is a method of overcoming stopped replication in which particular polyme...
Q: True OR False The DNA in the nucleus replicates before mitosis begins.
A: For the proper growth as well as development of an organism , cell division play a vital role . So ,...
Q: What ion is the major influence on the resting membrane potential? Explain its role.
A: Appropriate communication between neurons that help transmit and receive signals is required for pro...
Q: cells in the stomach secrete pepsinogen.
A: Pepsinogen is a highly strong or powerful protein-digesting enzyme that is released by the gastric m...
Q: Question 4. When the labeled antibody is attached directly to the antigen in the cell, what is the p...
A: Labeled antibody is attached directly to the antigen in the cell is process called is immunofluoresc...
Q: What information provided by Jamie would lead the physician to suspect a systemic disease? Include a...
A: We are allowed to do upto three subpart of a question. Please repost the undone question again. Tha...
Q: mtDNA is Select one: a. Double stranded linear DNA molecules b. Single stranded circular DNA molecul...
A: Introduction :- Mitochondrial DNA (mtDNA) has a number of unique characteristics, such as a high cop...
Q: by which living organisms are exposed to stimulus energies. by which bites of pizza enter the digest...
A: Introduction: A stimulus is a change in the external or internal environment which brings about a p...
Q: Why is Koch Robert considered an Interdisciplinary thinker. And prove how with the different fields ...
A: Heinrich Hermann Robert Koch (11 December 1843 – 27 May 1910) was a German physician and microbiolog...
Q: The value for the peak expiratory flow rate decrease in an individual with an upper respiratory trac...
A: Respiratory tract infection is caused by various pathogens and the common cold. There are also vario...
Q: mia is caused by gene mutation and transmitted by a recessive allele. Which genotype allows an indiv...
A: Mutation are also known as the sudden changes that causes defects in the genes. A change in one or ...
Q: Elucidate the potential reasons why there were changes in the bone structure of the vertebral column...
A: The central axis of the skeleton in all vertebrates is the vertebral column, also known as the spina...
Q: label the structure of spleen under microscope picture
A: Spleen is enclosed in a layer of connective tissue known as capsule. Spleen comprises red pulp and w...
Q: 5. To figure out the initial concentration of a bacterial culture, you made an 8 fold dilution of th...
A: The bacterial culture is diluted 10 times. This species that 1ml of initial concentration is mixed ...
Q: Which is the irreversible stage for progression of cell division? Select one: a. G1 b. S c. G2 d. M
A: The Cell cycle has 4 different stages namely:- G1, S, G2, and M. G1- It is a stage where the cell is...
Q: Most of the energy during x-ray generation is transferred from kinetic energy (the high-speed electr...
A: X ray generation takes place in x ray tube.The 99% of the kinetic energy is transferred into heat an...
Q: The basis for mechanical isolation is 1. _________________. Mechanical isolation is classified under...
A: Mechanical isolation It refers to the physical differences that are present between the species. The...
Q: he Rough Endoplasmic Reticulum is created from Smooth Endoplasmic Reticulum. Explain the molecules ...
A: INTRODUCTION The Endoplasmic reticulum are mainly found in all eukaryotes. In a animal cells the m...
Q: different
A: Interdisciplinary thinking is the ability to consider disciplinary perspectives concerning the pheno...
Q: Both hsp60-like and hsp 70 molecular chaperones share an affinity for exposed hydrophobic patches on...
A: Answer: Molecular chaperones are defined as the proteins that aid or help in the folding or unfoldin...
Q: In Coleus, the somatic cells are diploid. Having 24 chromosomes. How many of each of the following a...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Th...
Q: what are the backbones of trans fatty acid and the structure?
A: According to the question, we have to mention the backbones of trans fatty acid and the structure. S...
Q: How does biogeography explain the theory of evolution?
A: Introduction :- The study of the geographic distribution of plants, animals, and other forms of life...
Q: Why are Archaea resistant to penicillin?
A: Antibiotics are drugs that inhibit microbial growth or kill the bacteria without affecting the host....
Q: Describe briefly how important are the nervous and endocrine systems in the regulation of the respon...
A: Nervous system and endocrine system plays a important role in homeostasis and both work together.
Q: Expansins are activated by acidic conditions that modify the Select one: a. Hydrogen bonds between p...
A: Expansins are loosening proteins that function as loosening activity of plant cell walls.
Q: What are the 5 major components of a cell?
A: All living organisms are made up of cells. Cell is the basic structural components. Cells have a n...
Q: Gametes are formed in Select one: a. Mitosis b. Meiosis c. None of the above mentioned
A: Gametes are formed through meiosis (reduction division), in which a germ cell undergoes two fissions...
Q: Discuss reasons why population numbers would be important and how this data could be used to manage ...
A: Increased numbers of a particular species can affect the balance of ecosystem , as the increasing po...
Q: ..... On the diagram of a DNA molecule above, select the letter that labels the each component liste...
A: DNA Deoxyribonucleic acid is the genetic material of almost every eukaryotic organisms.
Q: a physiologist, which of the following terms should you immediately associate with negative feedback...
A: Homeostasis is the process in which the body maintains a near-constant internal environment. This is...
Q: Differential stains function to
A: The widely used staining method in the microbiology is the differential staining that are gram stain...
Q: a) In lane 5, draw what you would expect to see if you prepared a reaction using a nucleotide mix co...
A: If dideoxynucleotides were not added at all, we would get a single band with the entire sequence wit...
Q: A gardener received a pea plant from her neighbor, and she wants to know its genotype. The neighbor ...
A: homozygous dominant trait =round peas (RR) homozygous recessive trait=wrinkled peas (rr) Heterozygou...
Q: Describe what happened if there is no biodiversit
A: Biodiversity: The biological variety and variability of life on Earth is referred to as biodiversit...
Q: What is the difference between gram positive and gram negative bacteria? Describe how we use this to...
A: The following are the important differences between gram-positive and gram-negative bacteria: Gra...
Q: m. In the figure below, the bacterial activator protein CAP and the Lac repressor have been placed i...
A: Introduction :- The lac operon is a group of genes with a single promoter that encode genes for lact...
Q: 5 Describe the roles of GAP and GEF in activating GTPases?
A: GAP stands for GTPase activating proteins. GEF stands for Guanine nucleotide exchange factors .
Please answer fast
Find a genetically modified organism of interest. What organism is the origin of the coding sequence? What is the product of this recombinant gene? What is the commercial interest in this GMO? What are the ethical concerns with GMOs?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- PCR-based assay was used for the detection of Candida albicans, please help me answer the following questions so I can use them as a guide.What are the advantages and disadvantages of performing Molecular-based Assays over the routine diagnostic tests for the Candida albican identification? What is the basis for the nucleic acid extraction that you utilized in this assay? What is the basis for the choice of primers that you utilized in this assay? Elaborate. What are the potential sources of errors in the methods that you have utilized?What is dideoxy sequencing? Explain it please.The enzymes mentioned below are used as tools during cloning, DNA sequencing and/or gene therapy. Explain what they are used for. Also mention the actual biological function of the respective enzymes. 1) RNaseH
- What makes the species of Agrobacterium ideal for genetic engineering? Describe its characteristics and its role in producing transgenic plants.Topic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question Describe the molecular genetics process using proper scientific terminology. Describe the steps that are involved. How is it performed?Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC
- Fill the Table with mutagenic agents and provide their type (physical, chemical, biological) and their classification based on their effect (teratogenic, carcinogenic, clastogenic, or non-specific), together with their modes of action. Mutagen Type of Mutagen Classification based on effect Action UV – radiation X-Ray radiation Virus Heat 5-bromouracil Ethidium bromide 2-aminopurine Acridine orange Proflavine Cobalt Nickel Methylhydrazine Temozolomide Ethyl ethane sulfateAnswer each of the following correctly. Designer Genes Work (This is all about Applications of Recombinant DNA). 1. What is Genetically Modified Organism (GMO)?(1-4 sentences only) 2. Illustrate your own Designer genes using this information:The Arctic apple is a fruit engineered to resist browning after being cut. Currently they are only available in the US – in golden, fuji and gala varieties – where they have been given Food and Drug Administration approval. If approved in Europe, they would have to be labelled as genetically modified. The manufacturers claim the main benefit is to help cut down on food waste. And based on the following: a. Identify a special trait. b. Identify a source organism. c. Identify a target organism d. Identify the modified/added trait. Example: Hot Tomato > Chili > Tomato > Spicy Tomato It was reported this week that Brazilian scientists are hoping to create spicy tomatoes using Crispr gene-editing techniques. Although tomatoes…Why is gene editing becoming a trend in modern genetic engineering? Provide a concrete example on your explanation. 2. Out of 4 presented methodologies in gene modification/editing, which do you think is the most promising in providing efficient result? Why do you say so? 3. What makes the species of Agrobacterium ideal for genetic engineering? Describe its characteristics and its role in producing transgenic plants. 4. In which of the following aspects do you think it is worthwhile to develop genetic engineering? Why or why not? a.) Agriculture and Food Industry b.) Medicine c.)Research d.) Entertainment 5. What are the possible bioethical issues that gene editing tools may encounter? 6. Do you think genetic engineers play God when they modify the genes of various organisms to enhance their existing traits? Why or why not?
- What are "genetic biohackers" in reference to "do it yourself CRISPR kits"? Who is Josiah Zayner and what is he infamous for? Feel free to search that online...Explain why phenol:chloroform is used in the isolation of genomic DNA (What is the end result and what must you do for the desired effect)acconline.austincc.edu/ultra/courses/_891351_1/cl/outline O gel electrophoresis O PCR O genomic library DNA microarray A patient is suspected of having a certain type of cancer that involves several genes. Doctors want to determine whether this patient is expressing these cancer genes and to what leve each gene is being expressed. What technique may be used? O molecular cloning O CRISPR gene editing 5 genetic recombination that occurs naturally (think horizontal gene transfer, meioșis, fertilization, or mutations). Ar : Y EV АУ ΩΘΙ 用く X A MacBook Air & 8 88 Q V Ix % 0 8A EXE D B 图 Q 用图 5 d Show All † 19 EHR Immuniza