5 Describe the roles of GAP and GEF in activating GTPases?

Q: Describe the cis-acting elements that control tissuespecific transcription of eukaryotic…

A: The transcriptional machinery of eukaryotes consists of two regulatory components, namely the…

Q: 10.

A: Epigenetic regulation refers to the mechanisms that control gene expression without changing the…

Q: 19. After showing that Sox2 is able to bind to the Hes5 promoter, what are two future experiments…

A: The SRY-box containing gene 2 (Sox2) has long been associated with neural stem cell maintenance and…

Q: Combinatorial control of transcription factors refers to the phenomenon that: O A) small effector…

A: Transcription is the process in which the DNA is converted into mRNA and forms the part of the…

Q: List one example of AMPLIFICATION OF SIGNAL during the cell’s response to Hedgehog

A: * Hedgehog signalling pathway is important during embryogenesis to  controll proliferation of tissue…

Q: The transphosphorylation of STAT proteins by Jannus Kinase causes: a. formation of STAT heterodimers…

A: Solution - c is correct option- formation of stat heterodimer which act as transcription factor.

Q: Select the descriptions that are specific for a general transcription factor Select 2 correct…

A: Correct options are: Option A i.e. transcription factor can act to repress or activate a certain…

Q: Diagram the regulatory regions of a typical eukaryotic promoter and how they interact to regulate…

A: Gene expression is the process through which information from a gene is used to create a functioning…

Q: what is an attenuator? (in context of a prokaryotic operon )

A: Operons are prokaryotic arrangements of multiple genes under the control of a single promoter. The…

Q: Search about transcription elongation factor P-TEFb with its relationship with CDK9 and RNA Pol II,…

A: As the question contains an external link, according to the guidelines, external links can not be…

Q: Yes or no? is siRNA result of activity of argonaut? Does RNAi result permanently heritable in…

A: Yes, Argonaute proteins are the active part of RNA-induced silencing complex, cleaving the target…

Q: There is a promoter of a tumour suppressor gene in a mutant cancer cell line, and discover that…

A: DNA in our cells are highly condensed in order to accomodate them within the nucleus of our cell.…

Q: What happens in the patched-smoothened signaling system if the hedgehog is NOT present?  A. In the…

A: A gene is a genetic molecule that is passed down from one generation (parents) to the next…

Q: 94 In the arrested state (7-14 nucleotides) of elongation,   ( ) is required to reactivate…

A: In molecular biology, the central dogma explains a lot about the transcription  and translation in…

Q: P+OcZ-Y+A+// P¬O+Z+Y+A+ i) The lac operon consists of three structural genes, lacZ, lacY and lacA.…

A: The lactose operon (also known as the lac operon) is a set of genes that are specific for the uptake…

Q: Explain the use of cyclins and cyclin-dependent kinases(CDKs) ?

A: Cyclins are cellular elements that drive or regulate the events of the cell cycle by combining with…

Q: What is the effect of supper repressor (lacI^s) mutations?

A: Lac operon is a transcriptionally regulated system in E.coli which enables the bacteria to utilize…

Q: Q28. Which of the following is a sequence that would be likely to be bound by a transcription…

A: Transcription factor: To initiate transcription, eukaryotic RNA polymerase requires the help of…

Q: 1. You have identified a novel protein that shows structural similarity with NELF. You next examined…

A: NELF is a negative elongation factor that is composed of four distinct protein subunits. These…

Q: . What type of mutation of the lac repressor might be both constitu- tive and trans-dominant?

A: Trans-Dominant- A mutation in a regulatory gene that can control the expression of a structural gene…

Q: GQ8

A: The question is asking us to understand the effect of methylation of genes in prostate cancer cells…

Q: In the presence of excess tryptophan, a repressor protein binds the operator of the trp operon and…

A: positive gene regulation in the presence of lactose and low glucose , the lac operon is expressed 20…

Q: Describe the cis-acting elements that control tissue-specific transcription of eukaryotic…

A: Step 1 Transcription is the formation of RNA (ribonucleic acid) over the template of DNA…

Q: 2) Briefly describe 6 different ways that eukaryotic cells typically regulate Gene Expression

A: Gene expression is the process by which a particular or a set of genes are expressed with the help…

Q: Which type of eukaryotic regulatory proteins interacts with enhancers?

A: DNA acts as genetic material in most organisms. DNA is a double-stranded structure that is composed…

Q: Select the descriptions that are specific for a regulatory transcription factor (RTF) Select 4…

A: Genes are the fundamental unit of heredity. They store genetic information in the form of DNA, which…

Q: 11. Why is the control of gene expression so critical for all living organisms? To conserve energy…

A: 11) Why is the control of gene expression so critical for all living organisms? Ans ) all the above…

Q: List four intracellular mediators affected by G proteins.

A: The full form of G-proteins is guanine nucleotide-binding proteins. These are the integral membranes…

Q: on ni aliuzen en B. Gene A contains a base substitution that results in a nonsense mutation. HTW…

A: A non sense mutation is the one where a codon is converted to stop codon and there is premature…

Q: distinguish between IS and Tn transposableelements

A: The gene in prokaryotes and eukaryotes that are capable of moving from one position to another…

Q: How protein activity can be modulated by alternative splicing ?

A: The process of selecting distinct combinations of splice sites within a messenger RNA precursor…

Q: How does the protein SF 9G8 affect body fat in Drosophila melanogaster (fruit flies)?

A: Drosophila melanogaster is a fly species belonging to the Drosophilidae family. The species is often…

Q: Pls help ASAP

A: Gene expression is a procedure through which a gene's information is utilised in the creation of a…

Q: Describe the roles of P-loop NTPase domains in molecular motor proteins

A: Molecular motors are a type of protein that generates unidirectional mechanical motion, use a…

Q: What is the sequence of GC-rich box in 3' to 5' direction? GCGCGC GGGCGG CCGCCC GGCGGC

A: Introduction GC box increases the amount of transcription for that gene when present in a…

Q: How do the Arp2/3 complex and NPFs nucleate the assembly of actin filaments?

A: Introduction:- Actin filaments (F-actin) are linear polymers of globular actin (G-actin) subunits…

Q: 19. Explain the three main signal transduction mechanisms for GPCRs

A: G-protein-coupled receptors (GPCRs) transmit signals from the extracellular environment to cells.…

Q: 3.) How do cis-acting regulatory elements and trans-acting regulatory proteins act in coordination…

A: A trans-acting element is usually a DNA sequence that contains a gene. This gene encodes for a…

Q: S-Cdk is likely to be a [Select] The inhibitor of Ras is likely to be a [ Select] < The MAP kinase…

A: Cell signaling is the process by which cells communicate with each other and respond to signals from…

Q: GGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotype

A: The sequence of mRNA is CCCUCACAUAUGCCCUACUUCCGCUAA. CCC- PROLINE UCA - SERINE CAU - HISTIDINE AUG-…

Q: Discuss the regulation of transcription in eukaryotes, including the roles of transcription factors…

A: Introduction: Transcription is the mechanism by which an RNA copy of a gene sequence is produced.…

Q: Thousands of caspase substrateshave been identified. Which onesare the critical proteins that mustbe…

A: Introduction Apoptosis is known as programmed cell death. Whenever there are any lethal chromosomal…

Q: When is transcription over? f. What is splicing, how is it operated? What about alternative…

A: The transcription is the first key step of gene expression. The process of transcription is defined…

Q: 47. Define group transfer and its role in the cell (Hint: How are amino acids activated by aminoacyl…

A: The genetic code that was copied onto the mRNA is translated into a polypeptide by ribosomes with…

Prokaryotic evolution

The term evolution means the gradual change or a transformation from a simple or primitive state to a complex or advanced state. Prokaryotic evolution is a concept that involves the evolution of the form and function of most primitive organisms (prokaryotes) through several stages and changes to form diverse life as a part of organic evolution.