1. You order two primers from a company that synthesizes oligonucleotides. The primers have the exact same G and A content, but arranged differently. Primer 1 = GAGAGAGAGAGAGAGAGAGA Primer 2 = GGGGGGGGGGAAAAAAAAAA a) Which one would you expect to have the higher melting point? Explain. b) Based on your answer to (a), draw a melting curve for primer 1 (line) and primer 2 (dashed line). Be sure to label the axes, and the Tm. c) What does the Tm represent? Draw what you would expect Primer 2 to look like at the Tm.

1) Prepare the following enzymatic reaction, present it in tabulated form. In a final volume of 30 ul, where buffer 4 (10 ml). How much volume of each reagent would be used and how much of water? Is there any problem? 2) The DNA pol 1 enzyme comes at a concentration of 50,000 U/ml. You have to prepare a 50 ug PCR reaction where you must use 0.05 U/ml reaction. You add 10 ul of PCR buffer, 2 ng of tempered DNA that is at a concentration of 0.5 ng/ul, primers (which are at 200 mM) so that each one remains at a concentration of 200 uM, Mg+2 that is 5 mM (10 X), enzyme and water. Present the table of all the reagents included in the reaction, the volumes of each one in ul. Present where the initial and final concentration of each reagent applies. Assume you have micropipettes for all values.

Below is an EMSA showing four different reactions, A-D. In each tube there is some combination of labelled DNA probe, Protein X (the protein you are studying), and an antibody for Protein X. Identify which combination of components are found in each of the four reactions and explain how you determined that based on the molecular interactions being studied and your knowledge of gel electrophoresis. It is possible that multiple lanes have the same component(s). A B C D EMSA

H2N 1.) Look carefully at this nucleotide: N: N- Но-Р-О OH a.) Number the carbons in the sugar group. (Remember the "prime" symbols.) b.) Is this a purine or a pyrimidine? How do you know? c.) Would this nucleotide be used for DNA or RNA? How do you know? (Be specific.) d.) Is this nucleotide ready to be used for DNA replication or RNA transcription? Why/why not? e.) If this nucleotide were incorporated into a growing DNA or RNA strand, where would the next added nucleotide be attached to this one?

5- ddNTP differs from dNTP in..... and N is representing.. a) The first has no OH in both C 1,2, but dNTP has OH in C3 of the sugar/A, G.T.C. b) The first has no OH in both C 2 & 3, but dNTP has OH in C3 of the sugar/the bases. c) ddNTP is used to stop DNA elongation / nitrogen d) ddNTP has only one OH in C3/A,G,T.,C

For the following sequence please design an 18 base pair forward primer.  ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAG

1) The plot to the right shows the Oxygen Saturation of Hemoglobin (Hb) versus O2 concentration. a) The Kd between HBa and HBB chains is 100 nM. When L35S mutation (Leucine 35 → Serine) is introduced into the Hba chain the Kd changes to 300 mm. \^^^^^A^A Draw a dashed curve on the figure to the right that represents how this mutation would likely change the curve. Note: that I am asking for how a change in affinity between HBa and HBB chains will impact HB binding to O2 1.00 0.75- HB Y 0.50 HBa L35S HBa L35S D101P 0.25 0.00 0 2 4 po₂ (kPa) 6 b) How might this specific mutation alter the interaction between HBa and HBB chains? I am asking you to predict what Leu specifically might be doing here. 8 c) Now imagine that a second mutation is added to the HB¤ L35S mutant to generate an HBa L35S D101P double mutant. A measure of the double mutant shows that it has a Kg = 2 kPa, but does not change the binding of HBa and HBB. Draw a dotted line on the figure above that shows the resulting…

33. Gel filtration chromatography shows that the molecular weight of a protein is 240,000 Daltons. However, when the protein was subjected to SDS-PAGE in the absence of ß- mercaptoethanol, two polypeptides (100,000 Daltons, 140,000 Daltons) were identified. Furthermore, when the protein was subjected to SDS-PAGE in the presence of ß- mercaptoethanol, three polypeptides (100,000 Daltons, 90,000 Daltons, and 50,000 Daltons) were identified. Which of the following statements is true of the protein? A. The protein is composed of three polypeptides. B. The three-dimensional structure of the protein is stabilized by both covalent and non- covalent bonds. C. Both A and B. D. Neither A nor B. 34. What is purpose of SDS in SDS-PAGE? E. To selectively bind the target protein F. To maintain buffer pH in the gel G. To cause the separation of proteins to be on the basis of molecular weight only H. To initiate polymerization of acrylamide to form gel

Hi, can you help me with this? Thank you. Please Note: This is only ONE problem set so according to the policy, all questions should be answered. I only need help with numbers 1,4,5,8,9,10,11,12

The chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC.  2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?