Explain why the intersex condition supports the idea that sex and gender are non-binary and that “biologists may have been building a more nuanced view of sex, but society has yet to catch up. “
Q: A 3-point test cross produces the following numbers of offspring: What gene is in between the other…
A: Genes are DNA sequences of nucleotides that code for RNA, and RNA codes for a protein. In the case…
Q: DNA ligases will seal all nicks there are in the DNA strands during the replication process and in…
A: DNA nicks introduced during the process of replication, recombination or repair if left unchecked,…
Q: All of the following are muscles that control movements of the eyeball EXCEPT the O A orbicularis…
A: 1) movement of the eyeball is controlled by six extraocular muscles and these are the following:…
Q: Question 2: Is it just a regular cold or COVID-19? Compare and contrast the two infections. In your…
A: Within the twentieth century, the globe suffered pandemics. The pandemics, as horrifying and lethal…
Q: Which of the following is the most accurate statement regarding the problem with using life…
A: Option 3 Life expectancy give you average of country but significant differences within groups of…
Q: Natural selection favored dark-colored fur in the rock pocket mouse. The selective force on the…
A: Natural selection It is a natural biological process where organisms adapt and change there…
Q: f you lost your ability to walk, could you access all of your house? What would need to change?…
A: Whenever one loses their ability to walk, they become wheelchair bound. Hence, their house, car…
Q: What is the genetics/chromosome number of Podocarpus costalis? What is the phenology and…
A: The genus Podocarpus sensu latissimo (s.l.) was initially subdivided into eight sections. these…
Q: The principal DNA polymerase in eukaryotic leading strand DNA replication is: A DNA polymerase B…
A: * DNA polymerase catalyze the synthesis of DNA molecules from precursors of DNA which are essential…
Q: Q4.6. If calcium ions, each of which has a charge of +2 (Ca2*), moved OUT OF a neuron, and no other…
A: The Charge of the ion depends on the type of charge present on the moving ion. The Concentration…
Q: using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…
A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…
Q: Question 19 A transversion mutation would be replacing T by: (A) either A or G BU
A: Ans- In molecular genetics, transversion refers to as the point mutation in which purines are…
Q: The fact that some eukaryotic rRNAs are self-splicing indicates that A RNA structures are highly…
A: In eukaryotes, rRNA have a sigma factor which makes the self splicable and hence the highly variable…
Q: Which part of a cell allows nutrients and other material to enter or leave the cell ?
A:
Q: True or false: A polypeptide amino acid sequence ultimately determines the function of a protein. 
A: The proteins are made up of amino acids and these amino acids are together bounded by polypeptides.…
Q: The describes the situation where the gene pool of a population is determined by the genetics of a…
A: "Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Which of the following is not an example of homeostasis? Changing temperature Constant blood…
A: Homeostasis It is defined as the state of constant internal conditions( physical and chemical)…
Q: 12. Below is a diagram of a cell. Which of the following is true? a. The cell is a plant cell,…
A:
Q: 6. Tim is observing xylem vessel elements under the microscope. He initially used the low power…
A: Because The objective lens must be designed specifically for oil immersion microscopy. Attempting to…
Q: Rowena was tasked to measure the actual magnification of her specimen mounted on a slide without…
A: A microscope is a piece of scientific equipment which magnifies very small objects that are too…
Q: what is the name of this structure and what fun function and pathway does if take?
A: Introduction The reactions which help in converting pyruvic acid to carbon dioxide and water in…
Q: If you had a mixture of single-stranded DNA fragments, all 4 deoxyribonucleoside triphosphates, and…
A: DNA replication is the process of producing complementary DNA molecules from the ds DNA molecule.
Q: On the planet of Caracas, in the Stellar Solorais KaChunka Galaxy, there is a population of…
A: Given: The phenotype of interest is Peanutus01. There are two alleles for the autosomal gene…
Q: Phosphofructokinase (PFK) catalyzes a key step in glycolysis. This enzyme is composed of three…
A: The most common causes of anemia in the elderly are chronic disease and iron deficiency. Vitamin B12…
Q: All of the following describe a gamete, EXCEPT: a) sperm b) haploid c) zygote d) egg
A: Gametes are an organism's reproductive cells. They are also referred to as sex cells. Female gametes…
Q: Which of the stated relationships is correct? A. the heart is inferior to the clavicle B. the…
A: Introduction Proximal means close to or near the trunk or the origin of a part (example, the…
Q: Describe one characteristic you see in organism 3 which might have had an advantage over organism 2.…
A: *Darwin proposed that Fossil records provides evidence that the living organisms has evolved a…
Q: An extinction vortex describes a) changes in a population’s gene pool that lead to a loss in…
A: Answer- a) changes in a population’s gene pool that lead to a loss in fitness across time
Q: What causes internal splintering?
A: Splinter or silver is basically a small fragment of large object and can be considered as foreign…
Q: Match the description on the left side to the correct term from the choices on the right side.…
A: 51. --> option M. 52. --> option B. 53. --> option L. 54. --> option J and K…
Q: John, a 47-year-old white male, weighs 86 kg and is 1.7 m tall. Calculate his body fat percentage…
A: Body Mass Index BMI is an indication of fatness in the body. It measures the body fat depending on…
Q: In order for transcription to begin, the DNA-duplex must be "opened" to allow RNA polymerase access…
A: RNA polymerase is an enzyme found in the nucleoplasm of nucleus. It is involved in the…
Q: Question 2 DNA replication requires the participation of at least 8 nucleoside triphosphates. (A…
A: DNA replication is a process where two copies of daughter DNA are made from one parental DNA.…
Q: What are the parts of auricularis muscles and their specific functions? Tabulate the origin,…
A: The craniofacial muscles are a set of roughly 20 flat skeletal muscles that lie beneath the skin of…
Q: Do genes or alleles independently assort?
A: The alleles are the alternative forms of a gene that are located on the same locas of a homologous…
Q: Bat/Hedgehog/??
A: MERS is also called Middle East respiratory syndrome. It is a contagious, sometimes fatal…
Q: Compare and contrast the different transport mechanisms: Electrochemical gradient…
A: Factor Passive Diffusion Facilitated Diffusion Active Transport Electrochemical Gradient Present…
Q: Discuss the strengths and weakness of the traditional Innovative health financing mechanisms
A: The purpose of health financing is to make funding available, as well as to set the right financial…
Q: Pruning results in a greater photosynthetic area and therefore lesser foods are manufactured? True…
A: Introduction Pruning is when you selectively remove branches from a tree, It allows room for new…
Q: Hedgehog - Cell signaling pathway 1) describe its normal function and mechanism,
A: Answer
Q: In prokaryotes, the sigma factor recognizes base sequences in the . which facilitates RNA polymerase…
A: The major step of initiation of RNA synthesis is the facilitation of RNA polymerase binding. This is…
Q: A cell experiences a mutation where the DNA polymerase III enzyme can now add nucleotides to either…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: Question 44 The term RNA refers to RNA. Blank 1 Blank 1 Add your answer
A: INTRODUCTION Answer to the question 44 is given below.
Q: Match the different methods of analysis with the approaches in Glycomics Study of enzyme…
A: Glycomics is a subset of the field of glycobiology that aims to identify the structure and function…
Q: Choose the correct answer. These are chemical messenger that modulate the development of the…
A:
Q: What is the outgroup between deep sea Dragon and shiny loose jaw And 2 similarities and differences…
A: Cladistics or phylogenetics is the maximum usually used technique in the biological category. It…
Q: e the presence of saliva
A: Saliva is a thick, colourless, opalescent fluid that is constantly present in the mouth of humans…
Q: Rowena was tasked to measure the actual magnification of her specimen mounted on a slide without…
A: A microscope is a well-known they are about to define as the way that they are an instrument that…
Q: When the gene tree differs from the species tree due to the gene having great genetic variability,…
A: The genes are the main part of the DNA which helps in the regulation of the body function by the…
Q: Match the following methods of Anlaysis Fractional analysis, methylation, and periodate oxidation A.…
A: Introduction An enzyme is a type of protein found within a cell, these proteins helps to speed up…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- In a short essay (at least 10 well-defined sentences) Define Sex and Gender? What is the difference? Why can't we understand sex in terms of female and male or gender in terms of man and woman? Why can't we understand neither sex nor gender as binary? Give and shortly discuss at least 3 specific examples.According to the current scientific understanding of the topic, why is our gender identity is NOT a matter of choice?What defines our biological sex? What is the distinction between genetic and anatomical sexuality? Explain how chromosomes influence the internal and outward development of the sexual anatomy (hormones and structures). Is there always a correlation between genetic and anatomical sex? What is the reason, or why not? Describe a situation or disorder in which the internal and exterior sexual anatomy of a person do not match and explain how this would occur. Describe how a binary (male/female) model of sex does not reflect reality. What would a more accurate model look like?
- Explain how sex is an evolutionary force.explain the concept of the human life cycle. Please identify and explain, in detail, the various stages of the human life cycle. Explain gender pluralism and what it says about human nature.Explain the paradox and adaptive significance of sex. Provide examples and data thatsupport the theories regarding the evolution of sexual reproduction.
- Wedow et al. (2018) found that genes which predispose an individual towards gay sex: improve reproductive success in female siblings. are related to a higher number of heterosexual partners in the same individual are not a viable reproductive strategy are on the X geneWhat are some interesting facts of Equality in the Sexes in Human Evolution?Humans have been affected by genes and the environment, including the cultural environment. True False The secular trend in puberty has resulted in a decrease in the age of menarche in human females. True False According to “The Story of Race”, what did the eugenics movement in the U.S. seek to prove? That all men and women were biologically equal. That systematic discrimination against immigrants was unacceptable. That the racial superiority argument put forth by Nazi Germany was immoral and incorrect. That lower intelligence and criminal behavior were genetically based traits of the lesser races.
- What are some evidences about the Equality in the Sexes in Human Evolution?Four factors are considered when determining a person’s biological sex: 1) chromosomes, 2) hormones, 3) primary sex characteristics that are features essential for sexual reproduction (internal reproductive structures and external genitalia), and 4) secondary sex characteristics, features that typically appear during puberty and are different between the sexes, but are not directly involved in reproduction (for example, females typically have enlarged breasts and widened hips; and males typically have increased facial and body hair, increased muscle mass, and a larger Adam’s apple). Given that the top male athletes outcompete the top female athletes by about 10% in most sports, provide a justification for how each of these four factors is or is not likely to contribute to performance differences between sexes.Four factors are considered when determining a person’s biological sex: 1) chromosomes, 2) hormones, 3) primary sex characteristics that are features essential for sexual reproduction (internal reproductive structures and external genitalia), and 4) secondary sex characteristics, features that typically appear during puberty and are different between the sexes, but are not directly involved in reproduction (for example, females typically have enlarged breasts and widened hips; and males typically have increased facial and body hair, increased muscle mass, and a larger Adam’s apple). Given that the top male athletes outcompete the top female athletes by about 10% in most sports, provide a justification for how each of these four factors is or is not likely to contribute to performance differences between sexes. Factor that helps determine biological sex Likely to affect athletic performance? (Y/N) Justification Chromosomes Hormones…