Answered: edraw t

Science

Biology

edraw t

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter27: Protists

Section: Chapter Questions

Problem 10TYK: Endosymbioses that lead to the evolution of euglenoids and, separately, the evolution of...

See similar textbooks

Related questions

Q: What occurs as a result of the joining of sperm and ova? gametes meiosis mitosis zygotes

A: A sperm cell and an egg cell fusing together to create a single cell that contains the genetic…

Q: 21. What would be the outcome of cells expressing a key tricarboxylic cycle (TCA) enzyme lacking an…

A: The Krebs cycle also referred to as the citric acid cycle or the TCA cycle is a crucial metabolic…

Q: Common Glassware: write 5 uses of the following a) Petri Dish b. pipette write four uses of…

A: All these are common glasses which are used in laboratories in various experimental assays. Without…

Q: In point form, describe and explain how the organelles listed play a role in each major function in…

A: Introduction :- In cell biology, an organelle is a specialised subunit that typically resides inside…

Q: Define genomics, next - generation sequencing, and metagenomics. Create a paragraph that uses all of…

A: INTRODUCTION The genomics, next generation sequencing and metagenomics are briefly explained below.

Q: role of iron (Fe) in human body by focusing on Structure-Function-Location • how much of FE is…

A: Iron is an example of a micronutrient mineral that is needed in very small amounts by humans for a…

Q: a. Show (on the image) 3 steps that must be taken to produce a mature mRNA molecule from this pre-…

A: RNA Splicing: A newly created precursor messenger RNA (pre-mRNA) transcript is converted into a…

Q: Describe the anatomical and directional terms in locating the digestive structures of toad, fish and…

A: Introduction :- The digestive system is a series of organs that work together to break down food,…

Q: in great detail explain what a Nucleus is, the function, location and why it is so important.

A: Cell is the structural and functional unit of life.It is considered as the builiding block in the…

Q: Explain how aging and lifestyle can affect the health and strength of bone.

A: Our skeleton system is made up of bones. There are 206 bones present in adult human. According to…

Q: The integral membrane protein XYZR has a single alpha helix spanning the membrane. Where was this…

A: INTRODUCTION Integral membrane proteins are proteins that are embedded in biological membranes.…

Q: 0.09 How many in the population are homozygous dominant? How many people have wet ear wax (This is…

A: Hardy Weinberg Equilibrium or HWE states that the frequency of occurrence of specific alleles in a…

Q: There may be more than one answer for each Expression of mRNA can be regulated by which of the…

A: There are a few important points : RNA polymerase is responsible for the transcription of all…

Q: Would you expect an instrinsically disordered protein to contain a higher proportion of hydrophilic…

A: A protein is a macromolecule made up of one or more chains of amino acids. Proteins are essential…

Q: Match the group with its correct description or characteristic. kinetoplastid euglenoid ciliate…

A: Protists are a diverse group of single-celled or simple multicellular organisms classified as…

Q: How is it possible Jonathan has the dominant disorder, Huntington’s Disease, if none of his family…

A: Huntington's disease is a medical condition during which nerve cells start to degenerate over time.…

Q: discuss acute and latent infection and reactivation of members of the Herpesviridae

A: Introduction Herpesviridae is a family of DNA viruses that cause a variety of diseases in humans…

Q: Name the three types of mitral valve disorder and explain the pathogenesis and pathophysiology of…

A: Mitral valve disorders refer to the abnormal functioning of the mitral valve in the heart. The…

Q: Consider a cell that has four pairs of chromosomes. During meiosis I, how many different chromosome…

A: Introduction :- Meiosis I is a type of cell division that occurs in the formation of sperm and egg…

Q: A genetic counselor informs an expecting couple in their 40s that there is a risk of genetic disease…

A: Prenatal diagnostic tests are medical procedures used to look for any possible physical or genetic…

Q: A very large population of rabbits has been allowed to breed randomly in a laboratory research…

A: Introduction Phenotype refers to the physical and behavioral characteristics of an organism that…

Q: Briefly describe the good harvesting practices to optimize the post-harvest quality of fresh fruits…

A: Good harvesting practices plays huge role in maintenance of quality of fresh fruits and vegetables…

Q: Relative to other unicellular protists, how would you characterize the size of amoebas?

A: Amoebas are single-celled organisms that can be found in sewage, polluted water, streams, lakes,…

Q: What are advantages and disadvantages of asymmetrical body plan in animals?

A: INTRODUCTION Asymmetrical bodies are a unique type of physique that is characterized by having a…

Q: our plasn igest tub

A: Introduction: A plasmid is a small, circular, double-stranded DNA molecule that is separate from a…

Q: electrochemical gradient. What are the reactions, where do they occur, and why do these factors…

A: Electrochemical Radiant always consists of two gradients. First one is electrical gradient and the…

Q: What is the calculated “critical value” for this problem?

A: Hypothesis testing is the first step in any experimental research. At this step, two types of…

Q: Why is polyacrylamide gel is used in electrophoresis?

A: Introduction Electrophoresis is a widely used laboratory technique for separating and analyzing…

Q: 2. What are the roles of the egg in animal development?

A: 2.Animal development can be defined a series of events that leads to the formation of new organism…

Q: Draw the spectrum of pure DNA at the concentration of 50 ug/ml on the graph provided. List all…

A: Introduction: The genetic material that contains the instructions for the growth and operation of…

Q: Phenotypic ratio when crossing two pure-breeding organisms Tester for a test cross Independent…

A: Phenotypic ratio of a cross between two pure breeding organisms will result in all the progeny…

Q: 5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription…

A: Introduction : One of the earliest steps in gene expression is transcription. The transfer of…

Q: A. Explain how mutation causes variation. Give examples. B. Explain how meiosis causes genetic…

A: Introduction In genetics, variation is a critical component of evolution and adaptation, as it…

Q: A) Plot the time response of deformation for a 100 kDa globular protein under the constant for the…

A: Introduction: Protein is a macromolecule made up of amino acids. Proteins play critical roles in…

Q: A doctor assigns a newborn infant an Apgar scale score of 9. This means that the infant shows…

A: The Apgar score is a popular tool for assessing a newborn infant's physical condition shortly after…

Q: I’m kinda confused on what to study for the test and what questions are gonna be on there but this…

A: In the given slide , they wants to explain you about bacterial chromosome which is different from…

Q: 23a. If two proteins are functionally homologous then what does that mean about these proteins?…

A: Introduction : Proteins are large macromolecules having one or more polypeptide chains. A…

Q: A. Examine the following pedigree chart. Complete the missing labels and answer the questions that…

A: Introduction :- A pedigree is a graphical representation of the genetic and ancestral relationships…

Q: The mode of inheritance of the auricular hypertrichous trait in the Brown family is clearly an…

A: Auricular hypertrichosis is a phenotypic condition in which excessive hair growth takes place in or…

Q: T or F a)Quadrula and Radiatula each have glochidia that are unhooked – this must be a result of…

A: INTRODUCTION Quadrula is a genus of freshwater mussels, also known as pocketbook mussels. They are…

Q: The wild cress Arabidopsis thaliana is a diploid with 5 pairs of homologous chromosomes (i.e. 2n =…

A: Introduction :- Meiosis is a type of cell division that produces haploid cells, which contain half…

Q: In cats, pointed ears (E) are dominant to round ears (e), while black fur (F) is dominant to red…

A: Introduction A cross in genetics refers to the mating or breeding of two individuals to produce…

Q: Give two exa

A: Introduction: A disease is a condition that affects the normal functioning of an organism and can…

Q: 29d e f h please

A: Introduction: Energy and metabolism are closely related concepts in cellular biology. Metabolism…

Q: Dr. Thompson learned in her university genetics course to memorize probability outcomes from…

A: The inheritance is encoded by two genes. These are M and N genes. M gene has two alleles. These are…

Q: Define plaque-forming unit and explain its role in the quantification of viruses

A: INTRODUCTION Plaque-forming is a phenomenon seen in immunology research where antibodies are tested…

Q: hallmarks of an autosomal recessive trait

A: The hallmark feature of an autosomal recessive trait are:…

Q: esc Which of the following is an organ through which nutrients, gases, wastes are exchanged? 1…

A: Introduction :- The cloaca is a term used in anatomy to refer to a common cavity in which the…

Q: Using absorbance at 234 nm, 280 nm, and 260 nm, you calculated the percent of proteins present in…

A: Introduction :- A peptide is a short chain of amino acids linked together by peptide bonds. Peptides…

Q: You will read six articles from databases and assemble an outline, which will be posted in the…

A: Introduction: An artificial womb is a technology used for the growth and development of a fetus…

Concept explainers

Prokaryotic evolution

The term evolution means the gradual change or a transformation from a simple or primitive state to a complex or advanced state. Prokaryotic evolution is a concept that involves the evolution of the form and function of most primitive organisms (prokaryotes) through several stages and changes to form diverse life as a part of organic evolution.

Question

Redraw the phylogeny of eukaryotes, expanded to show different members (e.g. dinoflagellates, diatoms) of the supergroups as necessary and indicate the location of the primary endosymbioses for mitochondria and chlorophyll on the phylogeny. Indicate the location of three secondary endosymbioses leading to chloroplasts and one location showing the loss of mitochondria on the same phylogeny.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

DNA sequence data for a diplomonad, a euglenid, a plant, and an unidentified protist suggest that the unidentified species is most closely related to the diplomonad. Further studies reveal that the unknown species has fully functional mitochondria. Based on these data, at what point on the phylogenetic tree in Figure 1 did the mystery protist’s lineage probably diverge from other eukaryote lineages? Explain.
Does the following phylogenetic tree provide evidence to support or refute the endosymbiosis hypothesis? Briefly explain your choice (1-2 sentences) Bacteria a-Proteobacteria Mitochondria Archaea Eukarya Excavata Discicristata Alveolata Stramenopila Rhizaria Plantae Opisthokonta Amoebozoa
This chapter shows a phylogenetic tree for the three domains of life, which is based on DNA sequence data for rRNA and other genes. Which of the following answers concerning the phylogenetic relationships found within this tree is incorrect? View Available Hint(s)for Part A Euryarcheotes are found in the Archaea Diatoms, Tubulinids, and Euglenozoans belong to the domain Eukarya Forams, Fungi, and Chlamydias belong to the domain Eukarya. Spirochetes belong to the domain Bacteria Ciliates, Red Algae, and Plants belong to the domain Eukarya.
make a drawing of a phylogenetic tree that contains all 3 domains of life. The tree should include at least three different animals, two plants, chemoheterotrophic bacteria, photoautotrophic bacteria, chemoheterotrophic archaea, thermophilic archaea and fungi. Identify both primary endosymbiosis events on the tree and draw a line to connect it to the organism that would become the future organelle.
According to the endosymbiotic theory of the origin of eukaryotic cells, how did chloroplasts originate? -by tertiary endosymbiosis -through secondary endosymbiosis -from the nuclear envelope folding outward and forming mitochondrial membranes -from infoldings of the plasma membrane, coupled with mutations of genes for oxygen-using metabolism -through primary endosymbiosis
Except for the Plantae, what best describes the origin of chloroplasts in most other eukaryotes? Group of answer choices Chloroplasts evolved independently in different lineages Primary endosymbiosis An amoeboid protist engulfed another protist that had chloroplasts in its tissues Mitochondria were converted to perform photosynthetic functions Eukaryotes outside the Plantae don’t have chloroplasts
Describe the features of mitochondria and chloroplasts that support the endosymbiotic theory.
Briefly describe the three taxa involved in the secondary endosymbiosis and the one taxa that lost mitochondria.
Describe two ways in which paramecium differs from the projected traiits of the last eukaryotic common ancestor.
5)Which of the following observations constitutes evidence that mitochondria evolved before chloroplasts? Mitochondria are aerobic. Chloroplasts are photosynthetic. Aerobic bacteria evolved before photosynthetic bacteria (cyanobacteria). Some protists have separately evolved their own plastids (chloroplast-like structures) through endosymbiosis of cyanobacteria, or even through endosymbiosis of photosynthetic protists. All Eukaryotes have mitochondria; only a subset of Eukaryotes have chloroplasts.
Endosymbiosis greatly altered eukaryotes as they acquired organelles. In the red algae shown below, the mitochondria is on left (solid lines), the chloroplast is in the middle (dotted lines), and the nucleus is on the right (dashed lines).
Define the endosymbiotic theory. Explain how mitochondria and chloroplasts evolved by endosymbiosis. Explain 4 pieces of evidence for the Endosymbiotic Theory.