e) Draw a cartoon version of a lipid bilayer that illustrates the packing of several phospholipids in a membrane. Label the hydrophobic and the hydrophilic portions of the bilayer. f) Mycobacteria have an additional outer membrane called a mycomembrane comprised of unique lipids called mycolic acids. These fatty acids contain 30-90 carbon atoms compared to the typical plasma membrane fatty acids that contain 16-20 carbons. Based on these observations, which is more rigid and has a higher melting point the mycomembrane or the plasma membrane? Explain your answer.
Q: The pancreas is an organ of mixed secretion. Endocrinely, beta-cells produce the hormone insulin,…
A: Pancreas has 3 types of cells: α cells secrete glucagon β cells secrete insulin δ cells secrete…
Q: How does alteplase and mannitol affect a laboratory result? Why is it important to inform the lab…
A: Introduction An ischemic stroke is a condition when the blood supply to part of the brain is reduced…
Q: Explain what a competitive antagonist is using a named example. In your answer, explain why a…
A: Introduction: An antagonist is a substance that does not cause any biological response itself but…
Q: An equilibrium dialysis study was carried out with a ligand binding receptor protein. The protein…
A: Scatchard plot is a very useful plot to determine the affinity of association of ligand and a…
Q: hat roles do ionizable amino acids play in the active sites of enzymes
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Elongation of fatty acids chains beyond 16 carbons takes place: on the membrane of the endoplasmic…
A: Acetyl CoA from glucose oxidation or other anaplerotic reactions is produced in mitochondria and…
Q: Draw a lipid structure. Properly label the polar and non-polar ends of the representation of a lipid…
A: Lipids are compounds which are soluble in organic solvents and insoluble in polar solvents, i.e.,…
Q: Could you help with part d? Create a speciation diagram for histidine by plotting Xi vs pH from pH =…
A: His is a basic amino acids with pKa value of its side chain ~6, amine and carboxyl groups pKa values…
Q: Kinetic Parameters of Enzyme-Catalyzed Reactions TABLE 12-1 The Values of KM, Keat, and Keat/KM for…
A: For a one-substrate enzyme catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: how did you get 0.03x10^-4? Also, what is the final answer?
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: 2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: A plot of enzyme activity with and without an inhibitor present gave the following. Use two…
A: The rates of biochemical reactions are increased by proteins known as enzymes. Inhibitors are…
Q: 1.How many chiral center does D-Eranose have? 2. How many stereoisomer are possible for D-Eranose.
A: Conformation is the different positions a molecule can twist into. Configuration is the arrangement…
Q: Make a Concept Map about the Amino Acids. Separate them base on Essential, Non-Essential, and…
A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…
Q: Identify two (2) functions of lipids in the body. Explain each function in 2 sentences.
A: Lipids are a very important class of biological molecule. Lipids are a broader class of molecule…
Q: After doing the preliminary studies on redcrest protein extract, Tighnari proceeded with its…
A: Proteins are macromolecule comprised of amino acids linked by peptide bonds which forms a primary…
Q: 5. We're back in the lab having fun! Our current experiment calls for us to treat our cells with THC…
A: A stock or standard solution is one whose concentration is precisely known. Stock solutions can be…
Q: An individual's blood sugar is low. Assuming normal regulatory patterns, are the following ratios…
A: If the blood glucose level is low, we need to reduce the rate of glycolysis as there is insufficient…
Q: Why does adding acetic acid to the milk improve the extraction efficiency of the pentobarbital? You…
A: In liquid–liquid (solvent) extraction, the solute partitions itself between two immiscible phases.…
Q: Examine the membrane lipid pictured below and answer the following questions: a. Is this lipid…
A: Fatty acids are carboxylic acids with a hydrocarbon chain. Fatty acids may be saturated or…
Q: A new oxygen transport protein that exhibits cooperative binding has been isolated and is being…
A: Hemoglobin is an oligomeric protein with four polypeptide chains joined by non-covalent bonds. It is…
Q: Fill up the table below to summarize the confirmatory test for casein and whey. Test Sample…
A: Casein and whey are the 2 important classes of proteins in milk. The human milk composition is…
Q: Pathological Constituents of Urine Fill in the table below for your observations Pathological…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: The last residue of the protein (tail) is Tryptophan, and the first residue (head) is labeled with…
A: Fluorescence Resonance Energy Transfer (FRET) or simply RET is a technique used to calculate the…
Q: 2. Enzyme-catalyzed reactions. Answer the following with true or false. If false, explain why. (a)…
A: Enzyme is a biological catalyst, protein in nature which can increase the chemical reaction without…
Q: There is a proposal that pyrazole could protect against the damaging effects of alcohol on the liver…
A: Alcohol toxicity happens due to excess consumption of alcohol in short period of time. Oxidative…
Q: Mechanism of action of electron transport inhibitors. Amital.
A: INTRODUCTION : First of all, there is no electron transport inhibitor called Amital, it is a wrong…
Q: Which of the following are correct Dynein head elongates like a lever arm. ATP…
A: Movement of the body part is done by contraction and relaxation of contractile proteins.…
Q: Which of the following statements is correct regarding the structures below? CHO CHO H-OH ОН H-OH -н…
A: Monosaccharides are the simplest carbohydrates. Based on the functional groups, they are classified…
Q: After the first step in the metabolism of amino acids, which of the following statements are true?…
A: Metabolism is the total of all chemical transformation that takes place in a living cell. One…
Q: The hormone interacts with the metabotropic receptor, as a result of further implementation of the…
A: The G protein is a protein found associated with G protein-coupled receptors. The receptor coupled…
Q: You are performing PCR for the first time using some new primers that are 25 nucleotides in length…
A: PCR is the process by which we increase the number of a specific nucleotide sequence. The PCR…
Q: You are studying the DNA binding protein CLAMP and you want to determine its binding affinity for…
A: Introduction DNA acts as genetic material in our body. It is a double stranded molecule. mRNA is…
Q: Describe the structural similarities and differences of the following pairs. Identify which of these…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: Show a calculation of change in standard reduction potential that explains why succinate is not…
A: When two half reactions are paired in a redox reaction, the half reaction with the higher E°' will…
Q: 17-21 Is the rea (PEP) a re
A: Glycolysis is the process of breaking down glucose into two pyruvate molecules results in the…
Q: Glucagon is a hormone that indicates low blood glucose. A. Where is glucagon generated and released…
A: Carbohydrates that are obtained through the diet are digested into monosaccharides such as glucose…
Q: 3. Attach the structures below to draw a sphingolipid. CH3-(CH2) 12-CH=CH-CH-OH sphingosine CHINH,…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: 3. With a deficiency of thiamine - vitamin B1, beriberi disease (polyneuritis) occurs and…
A: Carbohydrates consumed in diet enter the glycolytic pathway as glucose. Pyruvate is the end product…
Q: true/false: N-acetyl glutamate regulates the urea cycle by increasing the transcription of the…
A: Urea cycle is an important catabolic pathway in which ammonia is removed from the body in the form…
Q: 5. Which of the following is true about myoglobin and/or hemoglobin? O (a) The iron in Hb is in the…
A: Both hemoglobin & myoglobin are globular proteins. Our red blood cells (RBCs) are composed of…
Q: Use a schematic diagram to briefly summarize the steps taken during the separation, isolation, and…
A: Milk is the secretion of fluid from the mammary gland, the full cream milk is composed of ~54.5%…
Q: If the following oligosaccharide was treated with an enzyme that cleaved only a1,4 glycosidic bonds,…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Discuss three of the major steroids derived from cholesterol and their physiological role.
A: Lipids are a chemically diverse group with two common characteristics: low solubility in water and…
Q: Which of these are artificial sweeteners (Arts) and which are metabolized (Mtbs) by glycolysis?…
A: Artificial sweeteners are synthetic substitutes for sugars. These are sweet in taste and have less…
Q: a) What amino acid is metabolite 1? b) What kind of reaction occurs when 1 is converted to 2? c)…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group attached to…
Q: Compare and contrast biochemical pathways. Describe the chemistry of the last three steps of the…
A: The citric acid cycle involves the oxidation of acetyl-CoA into CO2 and H2O. The beta-oxidation is…
Q: true/false: Pepsin cleavage of the peptide Ala-His-Gly-Trp-Val-Ile-Arg-Gly would yield the…
A: Pepsin is a proteolytic Enzyme that cleaves the peptide bonds with specificity. This can be used in…
Q: 1) Find the pH of 0.1 M of the differnet forms histidine species. (See image for equation and pKa…
A: Amino acids are building blocks of the proteins. Alpha carbon of amino acids consist of carboxyl…
Q: What is the main advantage of fluorescence polarization? Sensitivity of fluorescent probes Low cost…
A: FP is an analytical technique which provides information on orientation and mobility of…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- Part I. Protein structure You have the toy model for a protein in the water (W) environment of the cell shown. a) How many residues (amino acids) does this toy protein have? b) How many hydrophobic (H), hydrophilic (P), and charged (C) residues are there? c) Sketch the molecule on your answer sheet and then show the positions of the favorable C-C (charge-charge) interactions on the figure.Peptides. 1. Draw the peptide Ala-Glu-Gly-Lys, as it would occur at physiological pH = 7.4. The R groups of Ala and Gly are not acidic or basic, therefore do not have a pka and the charge on these R groups is therefore independent of pH. Glu is acidic and Lys is basic, therefore the charge on these amino acids is pH dependent. The pKas are shown below. pKa N-term = 9.0 C-term = 3.5 Glu4.1 Lys = 10.5 2. Draw a circle around the peptide bonds. 3. Label the C-terminus and the N-terminus. 4. What is the overall charge on the peptide at pH 7.4?11:14 structure. They provide the matrix or ground substance of extracellular tissue spaces in which collagen and elastin fibers are embedded. Hyaluronic acid, chondroitin 4-sulfate, heparin, are among the important glycosaminoglycans. 10. Glycoproteins are a group of biochemically important compounds with a variable composition of carbohydrate (1-90%), covalently bound to protein. Several enzymes, hormones, structural proteins and cellular receptors are in fact glycoproteins. Chapter 2: CARBOHYDRATES SELF-ASSESSMENT EXERCISES I. Essay questions 1. Define and classify carbohydrates with suitable examples. Add a note on the functions of carbohydrates. 2. Describe the structure and functions of mucopolysaccharides. 3. Give an account of the structural configuration of monosaccharides, with special reference to glucose. 4. Discuss the structure and functions of 3 biochemically important disaccharides. 5. Define polysaccharides and describe the structure of 3 homopolysaccharides. III. Fill…
- Protein Structure and Function A common strategy in the regulation of protein function is to alter its structure. Describe two specific strategies used by the cell to alter a protein’s structure, thereby altering its function.(a). Phospholipids are amphipathic molecules which have hydrophilic and hydrophobic regions. Explain how this feature benefits the cell. (Give ONE reason) (2) (b). Give ONE difference between a saturated phospholipid and an unsaturated phospholipid. (2)O d. Cooking oils e. Stearic acid (saturated fatty acids) Chitin, the structural polysaccharide forming the exoskeleton of arthropods has which of the following linkages Select one: O a. Hydrogen bonds O b. Glycosidic linkage between B glucose c. Ester linkage between a glucose O d. Ester linkage between B glucose O e. Glycosidic linkage between a glucose Finish attempt . e
- Protein Concept Map Add these terms to your concept map should include these concepts and details: Structure (functional groups, shape); Monomer; Linkage; Properties; Functions; Key terms from the Partial List of Key Terms from the Minds Partial List of Key Terms essential amino acid amino acid side group/R-group peptide bond polypeptide receptor neurotransmitter hormone secondary structure tertiary structure quaternary structure fair test hydrophobic hydrophilic intermolecular force of attractionComponents of Complex Biomolecules Figure 1-10 (Lehninger's Biochemistry book) shows the major components of complex biomolecules. For each of the two important biomolecules below (shown in their ionized forms at physiological pH), identify the constituents. And show H-bonding with water. (a) Guanosine triphosphate (GTP), an energy-rich nucleotide that serves as a precursor to RNA: N- NH -CH2 0- NH2 H H H H. ОН ОН (b) Phosphatidylcholine, a component of many membranes: CH3 O- CH3*N-CH2-CH2-0-P-0–CH2 нн CH3 НС —О—С—(CH), —С—С— (CH), — СHз CH,–0-C-(CH,)14–CH3Net charge Number of Identical Disulfide subunits Protein Molecular Weight at pH 7 subunits bonds 1 50,000 +3 1 No 50,000 (25,000 for each subunit) 2 -2 2 Yes No 25,000 Yes 100,000 (50,000 for each subunit) 4 -1 2 No Yes, between subunits 100,000 (25,000 for each subunit) 5 +2 4 No Yes, between all subunits
- Describe, The negatively charged glycosaminoglycan polysaccharide chains establish a hydrated gel-like environment around the cell.Choose Two. The Ramachandran plot indicates: B H Ca ||||||| Ⓒ. The C1 I A. Combined preference about both H しょしい O conformation preference for a C1-C² and c²_N bonde Existence of a peptide in an a-helical conformation Or P sheeted The prefered conformation about Can bond. The prefered conformation about C1-C² bond The prefesed conformation about peptide bond.Oe. Lactose, maltose 17 Water can be converted from the liquid status to gas/vapor by high temperature (100°C), which of the following are responsible for increasing the boiling point of water molecule? ut of Select one: O a. Covalent bond and adhesion nestion O b. Hydrogen bond and cohesion O c. Hydrogen bond and salt formation O d. lonization and cohesion O e. Covalent bond and adhesion Protein conformation depends on the... Select one: of O a. R groups of the composing amino acids O b. Carboxyl group COOH ion O c. Number of peptide bonds O d. Phosphate group O e. Amino group NH2