During replication, proofreading is accomplished by _____ and removes the incorrect base __

During replication, proofreading is accomplished by ___ and removes the incorrect base

Name: During replication, proofreading is accomplished by _____ and removes
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: During replication, proofreading is accomplished by _____ and removes the incorrect base ____a. DNA pol III 5’-3’b. DNA pol I 3’-5’c. DNA pol III 3’-5’d. DNA pol I 5’-3’

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter15: Studying And Manipulating Genomes

Section: Chapter Questions

Problem 16SQ: Match the method with the appropriate enzyme. _____ PCR a. Taq polymerase _____ cutting DNA b. DNA...

See similar textbooks

Similar questions

F H. A B D H G OVERVIEW D 1. lagging strand 2. DNA polymerase v B 3. origin of replication 4. binding proteins V E 5. primase v F 6. ligase v G 7. leading strand V H 8. helicase Click Save and Submit to save and submit. Click Save AllAnswers to save all answers. > > > > > > > >
GD Label the sugar and phosphate. Label the bases that are not already labeled
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
B 6000 5100 Number of Fragment(s) 4000 100 pX 6000 bp 3000 A A 1500 2000 A B 10. Based on the restriction map of the above plasmid, determine the number of DNA fragment(s) and the size(s) of the fragment(s). Digestion with Enzyme A Enzyme B Enzyme C Enzyme A + B Enzymes A + C Enzyme B+ C Enzyme A + B + C Fragment size(s) in base pairs
A Meselson-Stahl-experiment was performed to study the DNA replication of a newly discovered bacterium. This bacterium takes 30 min to complete a round of replication at 37° C. Figure 2.1 shows the autoradiography of the replicating DNA molecule. B A C D Figure 2.1 (i) Describe the steps of the Meselson-Stahl-experiment.
a. Pfu Polymerase b.dNTPs c.Buffer Match each component above to the correct function(s) listed below. Write your selection(s) for each component. You may have more than one answer for each. 1. unwinds DNA 2. synthesizes new DNA strands 3. enzymatically catalyzes Quikchange 4. nucleotide source for new DNA strands 5. Energy source for reaction(s) 6. Repairs errors in base pair matching 7. Maintains pH and salt levels 8. Creates polymer chains
Choices: Origin of replication Bubble SSBP RPA Sliding Clamp PCNA DNA Pol III Pol ε Pol δ DNA Pol I RNAse H Flap 1 DNA gyrase Pol α DNA helicase Primase Single chromosome Multiple points in chromosomes DNA ligase Not applicable 12.Proof reading in eukaryotic DNA material 13.Removal of eukaryotic primer 14.Adds more nucleotides in the lagging strand of eukaryotes 15.Holds the processive enzyme in eukaryotes 16.Holds the processive enzyme in prokaryotes
The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction. The peaks are shown with shortest fragment on the left to longer fragments on the right. T •C A Select the DNA sequence that matches the data. 5-ТАТAСТТАСGAAGT-3' 5'-GTCCTACGGACGCG–3' 5'-ATATGAATGCTTCA–3' 5'-TGAAGCATTCATAT–3' 5-АСТТCGTAAGTATA-3'
A Meselson-Stahl-experiment was performed to study the DNA replication of a newly discovered bacterium. This bacterium takes 30 min to complete a round of replication at 37° C. Figure 2.1 shows the autoradiography of the replicating DNA molecule. B A C D Figure 2.1 (i) Describe the result of this experiment.
5) Answers to the following questions. A. You are given a tube containing 275 ng of purified PCR product (DNA) that is 1262 bp long. How many picomoles of PCR product are in the tube? The average weight of a deoxynucleotide monophosphate is 328 g/mol. B. You digest a 5 kb plasmid with two enzymes that yield fragments of 4 kb and 1 kb, and resolve the digest on the gel. What would you predict to see in terms of the intensities of the bands?
DNA polymerase with 5'-3' as well as 3'-5' exonuclease and proofreading activity is Select one: a. Telomerase b. DNA Pol-I c. DNA pol-III d. Primase
32)An origin of replication is given below. Sequences of selected parental strand regions are given. The directionality of the bottom parental strand is indicated. Use the diagram to answer the corresponding questions. #2 *1 CTAAGCA ATCGAGG XXXXX XXXX 3' ICTAGTT 5' ge exon #3 a.) On the diagram, label the 5' and 3' end of the top strand of parental DNA b Draw arrows to indicate direction of DNA synthesis for each of the 4 daughter strands. e) For each daughter strand, specify if synthesis is continuous or discontinuous. d) On your diagram, label the 5' and 3' ends of the newly synthesized daughter strands e.) Which parental strands are the template for leading strand synthesis? (# 1- 4) Strand # Strand # f.) Which parental strands are the template for lagging strand synthesis? (# 1- 4) Strand # Strand # g.) What is the specific sequence of the primer required to start DNA replication ior strands 1 and 3? Assume the primer will bind to the location where the base sequence is given on…