During hibernation (in animals like the brown bear), after the body’s supply of carbohydrates and excess polypeptides have been used for energy, the hibernating animal must switch to using:
Q: R Identify the cellular morphology for this Gram stain. What is the Gram reaction? What is the…
A: The gram staining process is staining technique that is used to classify bacteria into two large…
Q: Apple puree was analyzed for petulin by HPLC-MS-MS after SPE clean-up. The procedure was 10.0g of…
A: This query involves the determination of patulin, a mycotoxin produced by certain molds (e.g.,…
Q: What makes automation of the polymerase chain reaction much easier? a. Capillary electrophoresis b.…
A: PCR means polymerase Chain Reaction. This is a procedure where a given target sequence can be…
Q: 12. The body's front line defense is natural killing T cells that spray a poison onto the virus…
A: The immune response is a complex biological process that involves the body's immune system working…
Q: 15.26) In transamination reactions, a-ketoglutarate is converted to glutamic acid. The other…
A: Amino acid catabolism refers to the process by which amino acids are broken down and converted into…
Q: The genes described below are part of the yeast mating signal transduction pathway that signals the…
A: The yeast mating signal transduction pathway is a signaling cascade that allows yeast cells to…
Q: Complete each sentence with the appropriate term or phrase. (Each box can be used more than once,…
A: DNA loops are formed when specific DNA sequences, called insulators, are brought into close…
Q: Answer with true or false for each statement: A. The Anthropocene is proposed to represent the…
A: The Anthropocene is a proposed geological epoch that represents the current era in which human…
Q: Identify the open reading frame for the following sequence: CACAGCCTACTAATGGTGTTGGCTAT Note: When I…
A: To identify the open reading frame (ORF) in a given DNA sequence, we need to locate the start codon…
Q: Discuss food-web relationships in eutrophic reservoirs and how food web manipulation can be used to…
A: The food web normally consists of the mesh of various food chains in an ecosystem. It shows the…
Q: 5) In DNA replication, which of the following events happens during both leading and lagging strand…
A: We will examine the molecular mechanisms underlying DNA replication, focusing on the differences…
Q: Purple loosestrife (Lythrum salicaria) and musk thistle (Carduus nutans) are ruderal plants that are…
A: On the basis of growth rate there are two kinds of curves obtained - one is the growth curve…
Q: Pathways to cell death in ischaemia There are many overlapping and interacting events and…
A: An embolism or thrombosis-induced disruption in cerebral blood flow results in an ischemic stroke.…
Q: True or false Tolerance to commensal microbes can be broken and effector immune responses elicited…
A: The gastrointestinal (GI) epithelium is the layer of cells that lines the surface of the digestive…
Q: What is the pathogenesis of poliomyelitis?
A: Poliomyelitis commonly known as polio is a viral infection caused by the poliovirus. The…
Q: Which of the following transgenic animals would be most useful to determine which spliced form (or…
A: Molecular analysis is a broad term that refers to the techniques and methods used to study the…
Q: When Sperry and colleagues ablated the dorsal RGCs, the remaining ventral RGCs projected to the…
A: The expression patterns of Ephs and ephrins suggest that they may be involved in the mechanism used…
Q: Fill in the blanks with the correct terms, indicating increasinglylarger and more complex…
A: Living organisms show a particular hierarchy of living organisation that ranges from atoms to more…
Q: You have identified a Drosophila gene that is expressed exclusively in the odd-numbered "stripes" in…
A: A loss-of-function mutation is a type of genetic mutation that disrupts the normal function of a…
Q: Look at the nutrition labels for a Blueberry Nutrigrain Bar and a Blueberry RX Bar, also paying…
A: By examining their nutrition labels and ingredient lists, we can gain insights into the differences…
Q: e "RNA world hypothesis"... O maintains that RNA originally served as the main energy source of…
A: One of the earliest stages of biological evolution was the chance formation of an RNA molecule that…
Q: 15.23) Explain the difference between ketogenesis and ketoacidosis.
A: Cell is an elemental unit of the body in which lots of metabolic activities takes place. It…
Q: Blood pH is maintained at a range of 7.4. The following set of equations represents the reactions of…
A: The Henderson-Hasselbalch equation is helps in determining the pH of a solution using pKa and known…
Q: How do ecologists estimate population sizes? Provide examples for both plants (which do not move)…
A: Ecologists estimate population sizes by using various sampling and surveying techniques. These…
Q: dicuss the role of the nervous system and endocrine systems in temperature regulation, stress…
A: The nervous system is a vast network of neurons present throughout the body that makes use of…
Q: 11. Provide examples of at least five behaviors related to cultural competency that are considered…
A: Electronic waste, commonly known as e-waste, poses significant hazards to human health and the…
Q: 15.31) Match each of the following descriptions with the appropriate anabolic processes.…
A: Anabolic process is a constructive process, by which simple molecules were simpler molecules were…
Q: Which of the following is a condition that arises from the inappropriate formation of antibodies…
A: The inappropriate formation of antibodies that react with normal antigens of the glomeruli can lead…
Q: (1) You are the pharmacovigilance officer working for Paeon Pharma; they hold marketing…
A:
Q: What is the relationship between logistic and exponential growth?
A: Exponential or J shaped growth It occurs when the resources are abundant. Population passes well…
Q: what are the short comings of randomized clinical trials ?
A: A randomized clinical trial (RCT) is a research design that involves randomly assigning participants…
Q: 7. In humans, the allele for the condition called "hitchhiker's thumb" (h) is thought to be…
A: Dominant traits are expressed when the individual is homozygous for the dominant allele or…
Q: The creature should have at least 5 out of 6 genetic traits from the following list. You are free to…
A: Genes determine traits. Alleles are variants of a gene. Genotype is the genetic makeup of an…
Q: How do plants make their own food
A: Green plants are called producers because they supply food to the entire living Kingdom. For this…
Q: When Dr. Linda Fedigan conducted her studies on menopause, she collected data from the following…
A: The conclusion of Dr. Linda Fedigan from her study was that human female have only limited…
Q: 32.Provide two examples of primary prevention in community mental health.
A: Two examples of primary prevention in community mental health are: 1.Mental health education…
Q: According to the web article 'Evolution in real time', Dr. Richard Lenski has raised about…
A: Evolution is the process where genetic variations are accumulated in a population over a period of…
Q: Hydrophobic signaling molecules act by a. binding to plasma proteins b. starting second messenger…
A: Hydrophobic signaling molecules also known as lipophilic or nonpolar signaling molecules are…
Q: 34.Describe the Safe Schools/Healthy Students Framework.
A: The Safe Schools/Healthy Students (SS/HS) Framework is a comprehensive approach to promoting healthy…
Q: Aerobic respiration differs from anaerobic respiration in which aspect? O The presence of oxygen as…
A: Cellular respiration is the metabolic process by which cells convert nutrients, primarily glucose,…
Q: Which change to the skin is expected in early adulthood? increased elasticity appearance of wrinkles…
A: The term "adulthood" refers to a period in human development marked by mental, physical, and…
Q: Describe carrying capacity in terms of population growth.
A: The increase in the number of people in a population which increase the number of people in a…
Q: 15.15) The reduced coenzymes generated by the citric acid cycle (and beta-oxidation) donate…
A: Oxidative phosphorylation is the process by which ATP (adenosine triphosphate) is synthesized in the…
Q: The number of bacterial cells in a culture broth is to be determined by a culture technique. Serial…
A: Colony forming unit refers to the measurement of the number of viable cells present in per ml of the…
Q: Identify and label the following (if present on slide) a. mucosa, submucosa, muscularis externa,…
A: The small intestine is a part of the digestive system that is responsible for the absorption of…
Q: The three types of membrane proteins are: integral membrane proteins, peripheral membrane proteins,…
A: The cell membrane is a selectively permeable barrier that separates the internal environment of a…
Q: Describe 3 age-related changes in the lungs that have a negative impact on preventing lung…
A: The lungs are vital organs located within the chest cavity that play a crucial role in the…
Q: What molecular genetic method(s) or approaches would you use to test whether a transcription factor…
A: Transcription refers to the molecular process by which a cell synthesizes RNA from its genetic…
During hibernation (in animals like the brown bear), after the body’s supply of carbohydrates and excess polypeptides have been used for energy, the hibernating animal must switch to using:
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- hGH is an important part of fat metabolism, muscle development, and bone growth. Synthetic hGH can be used to treat children and adults suffering from hGH deficiency. More recently, competitive athletes have began taking hGH in an attempt to improve athletic performance. The use of hGH for athletics is banned by many major sporting organizations. A recent study of 44 athletes who took daily injections of hGH over 20 days showed that, on average, the athletes gained 4.2 lbs of muscle, but the gain in muscle did not translate to increased athletic performance.Evaluate each statement regarding the use of hGH by competitive athletes to determine whether the statement is an example of an ethical, economical, societal, or environmental issue. Athletes who play professional sports should be encouraged to take synthetic hormones to improve performance because their job is to win. Athletes who took hGH did not improve their sport performance but did improve their appearance and marketability.…Athletes often use whey products to prepare for competition because whey proteins: Group of answer choices are mild stimulants that produce alertness and reduce reaction time provide all the essential amino acids needed to build new muscle tissue elevate testosterone and estrogen in the blood of male and female athletes, respectively produce rapid weight loss by burning excess body fat and sparing glycogen produce free radicals that promote many of the body's beneficial responses to exerciseAt Kate's next appointment, Paula showed Kate how to use a glucose meter. She instructed Kate to measure her blood glucose level twice a day before and after breakfast and dinner. Paula explains to Kate that her pre-meal blood glucose level should be 110 mg/dLmg/dL or less, and if it increases by more than 50 mg/dLmg/dL, she needs to lower the amount of carbohydrates she consumes. Kate and Paula proceed to plan several meals. Because a meal should contain about 45 to 60 gg of carbohydrates, they combined fruits and vegetables that have high and low levels of carbohydrates in the same meal to stay within the recommended range. Kate and Paula also discuss the fact that complex carbohydrates in the body take longer to break down into glucose and, therefore, raise the blood sugar level more gradually. Kate increased her exercise to walking 30 minutes twice a day. She began to change her diet by eating 6 small meals a day consisting of more fruits and vegetables without starch such as green…
- Glycogen depletion resulting from intense, extensive exercise can lead to exhaustion and the inability to continue exercising. Some people also experience dizziness, an inability to concentrate, and a loss of muscle control. Account for these symptoms.You are a researcher seeking to determine if an experimental drug can effectively treat hyperglycemia, a condition characterized by excess glucose in the blood, often associated with Type I diabetes. You select 24 hyperglycemia patients to study, and you give half of them a pill containing the drug you are testing and the other half a placebo (a pill that lacks the drug ingredient). After an evening of fasting, you measure the amount of glucose in their blood the next morning. Write the null and alternative hypotheses appropriate for your study. Which treatment is your control group, and why does your experimental design require a control group? Describe the structure of a carbohydrate, and what are the functions of carbohydrates in the body? What test that we have used before in lab could you use to measure the amount of glucose in their blood? Describe how you would use this test to measure the amounts of glucose in their blood serum samples. Identify the dependent variable…A well-trained athlete is found to have a moderately increased plasma total cholesterol concentration. What additional measurements would you advise this person to take in order to gain a better understanding of the importance of the increased cholesterol? Hint: Think about the forms in which cholesterol exists in the blood.
- Some animals adjust their temperature by absorbing heat from their environment. These ectotherms ("cold blooded"), such as a snake or turtle, control temperature by moving to the sun or into the shade. As a result, their temperature fluctuates considerably through the day and night. Other animals generate heat internally. These endotherms (mammals and birds) burn fat and sugar to convert them to heat and so stabilize their body temperatures. Draw energy diagrams for the following processes: 9 10 beisibni yhsalb 20 eere v coubjere a) A snake warming up by basking in the sun erdd asbulani iorlt megsib yaena nago nA b) A boy warming up by running frog cooling down by hiding behind a rock biloz to assig s gnimeW (s 00s yilsitini soi gnidism ylisihe9 (d ) A dog avoiding overheating by pantingBodybuilders that take anabolic steroids such as androstenedione and testosterone often suffer from gynecomasty (enlarged breasts) as a side effect. Knowing that in women breast growth is stimulated by estrogens, explain why this happens to bodybuilders using the law of mass action. Again, make sure to mention the substrate and product of the reaction. View keyboard shortcutsConsumption of dinitrophenol by animals results in an immediate increase in body temperature. Explain the phenomenon. Why is dinitrophenol not used as a diet aid?
- The purpose of this assignment is to explain how energy is extracted from foods and used to produce ATP and also describe how the body synthesizes new molecules.On Thursdays, you get together with friends to play soccer at the park. One of your friends, Jenny, recently started a high fat, low carbohydrate diet. She commented to you that she feels sluggish and tired when she plays soccer. Based on your knowledge of exercise and fuel sources, explain why she feels this way.Since ancient times it has been observed that certain game birds, such as grouse, quail, and pheasants, are easily fatigued. The Greek historian Xenophon wrote: “The bustards . . . can be caught if one is quick in starting them up, for they will fly only a short distance, like partridges, and soon tire; and their flesh is delicious.” The flight muscles of game birds rely almost entirely on the use of glucose 1-phosphate for energy, in the form of ATP . The glucose 1-phosphate is formed by the breakdown of stored muscle glycogen, catalyzed by the enzyme glycogen phosphorylase. The rate of ATP production is limited by the rate at which glycogen can be broken down. During a “panic flight,” the game bird’s rate ofglycogen breakdown is quite high, approximately 120 mmol/min of glucose 1-phosphate produced per gram of fresh tissue. Given that the flight muscles usually contain about 0.35% glycogen by weight, calculate how long a game bird can fly. (Assume the average molecular weight of a…