Draw the expected organic product from the reaction of 1-chloro-2,4-dinitrobenzene with CH3CH₂ON. Give detailed Solution with explanation needed with reaction. don't give Handwritten answer ! :☐
Q: Draw the alcohol product that forms after the following two-step reaction. Be sure to include all…
A:
Q: Sally is planning for Part C of the Trends in the Periodic Table lab. Which chemicals would be…
A: The objective of the question is to identify the appropriate chemicals that Sally can use to…
Q: For the following electrocyclic ring-opening reaction 1. Choose the correct product. C To preview…
A: Step 1: Step 2: Step 3: Step 4:
Q: ;$;);):)):)););;)
A:
Q: 78. A 30.0-mL sample of 0.165 M propanoic acid is titrated with 0.300 M KOH. Calculate the pH at…
A:
Q: 2. A similar experiment is performed to determine the empirical formula of an oxide of copper, and…
A: Given: Mass of crucible, cover and copper sample = 21.53 g Mass of empty crucible with cover = 19.66…
Q: 18.68 Draw a stepwise mechanism for the following reaction. H H₂O* NH3
A: Step 1:Given reaction Step 2:Mechanism Step 3: Step 4:
Q: Show the synthesis of the following using intramolecular reaction (ring closing):
A: Step 1: Step 2: Step 3: Step 4:
Q: Two pairs of compounds are shown, where one compound has a melting point that is much higher than…
A: The compounds with the greater melting point are:1B2B
Q: Name: Car 5. Determine ASPxn, AH, and AGxn (each in kJ mol¹ to two decimal places) and determine the…
A: Step 1: Step 2: Step 3: Step 4:
Q: Provide a concise explanation of Mass spectrometry (MS) in regard to food samples. include the…
A: **Specific Application Name:**Identification and Quantification of Pesticides in Apples**Sample…
Q: ← Problem 32 of 37 Submit Draw the product of this reaction. Ignore inorganic byproducts. H На сво H…
A: D-Glucose is a simple sugar that is produced by plants through photosynthesis. D-glucose is the most…
Q: The type your answer... of solubility by addition of a salt containing a like or common ion is…
A: The reduction of solubility by addition of a salt containin like or common ion is called the "common…
Q: A sample solution containing quinine was analysed by fluorescence spectroscopy. 5 mL of the sample…
A: To calculate the quinine content of the sample solution in mg/mL, follow these steps:1. **Correct…
Q: the video shows color changing everytime he adds a solution to it. solors just as plane and both…
A: Key ScenesIntroduction of Dry IceThe professor introduces a solid block of dry ice into a large test…
Q: Synthesis: Give the correct starting material, reagents used or product as indicated. If you are not…
A: 1) Under reductive conditions, ozonolysis produces ketone or aldehyde upon cleavage of alkene or an…
Q: A reaction was shown to follow second-order kinetics. How much time is required for [A] to change…
A:
Q: Measure initial buret volume by measuring the level of the meniscus in buret
A: Step 1:In measuring the volume of clear solution in a buret, we should look at the lower meniscus…
Q: O Kinetics and Equilibrium Calculating an equilibrium constant from a heterogeneous equilibrium...…
A: Step 1:Introduction to question :Given ,Reaction : CaCO3 (s)→CaO(s)+CO2(g)Objective : Calculate the…
Q: In an order 1 kinetic reaction, I have the following data table: t/ °C 300 0,00004 200 0,004 How…
A: The equation of half-life for first order reaction is:The rate constant (k) is highly dependent on…
Q: 7. What is the major product? NaOH c. ? a. b. d. e. not a.-d.
A: Step 1: **Substitution Nucleophilic unimolecular reaction, or SN1 :** 1) There are two stages to…
Q: Draw a mechanism for the deprotection mechanism between Probe 1c and disulfide. It is fine to…
A: **Step 2: The General Mechanism**In biochemical contexts, the "deprotection" usually refers to the…
Q: please answer in text form and in proper format answer with must explanation , calculation for each…
A: EXPLAINED ABOVE IN DETAILED
Q: 4ZnS + 602 = 4ZnO +4SO2 determine the mass of zinc oxide produced when 16.7g of zinc sulfide is…
A: Thank you
Q: A compound has a strong absorption at 8.37x1015 Hz. What is the Amax( in Å (angstroms)) for this…
A: In the given question, we have to convert the given frequency (8.37 x 1015 Hz) into wavelength in…
Q: Draw the principal form of alanine at pH 2.00. At pH 10.00 where H2A+ -> H+ + HA has a pKa of…
A: Alanine Structure and Ionizable Groups:Alanine is an amino acid with the following structure and…
Q: Boron is an anomaly in Group 13 in that it forms covalent compounds rather than ionic Suggest an…
A:
Q: Predict the major products of the following reaction. Be sure to show the stereochemistry of the…
A: Step 1: Step 2:Mechanism Step 3: Step 4:
Q: Steam reforming of methane (CH4) produces "synthesis gas," a mixture of carbon monoxide gas and…
A:
Q: Kinetics and Equilibrium Calculating an equilibrium constant from a heterogeneous equilibrium... Try…
A: Given:…
Q: Increasing Energy 15. Complete the electron configuration diagram below for a neutral Sb atom. 7p 6d…
A:
Q: For this question: How SPF blocks UV Rays from the sun please provide a link of a 1 minute video…
A: UV rays, or ultraviolet rays, are a form of electromagnetic radiation emitted by the sun. They have…
Q: What would be the major product(s) of the following reaction? །། Brtw HO 20°C (CH3)2CHCH20 I…
A: Tertiary alkyl halide in the presence of alcohol will either undergo SN1 (nucleophilic substitution…
Q: 2. For the following mechanism questions, please refer to Chapter 8.10 in the Klein text for more…
A: The objective of the question is to understand the mechanism of formation of cis- and trans- isomers…
Q: 68) A 25.0-mL sample of 0.150 M HN3 is titrated with a 0.150 M NaOH solution. What is the pH after…
A: Given: VHN3=25.0mL;[HN3]=0.150M;VNaOH=13.3mL;[OH−]=0.150MKa=1.9x10−5;pH=???Step 1: Write the…
Q: Stoichiometry Record the mass of the empty beaker 103.05g Record the mass of sodium sulfate used…
A: Step 1:Step 2:Percent yield≈84.96%Therefore, the percent yield of calcium sulfate is approximately…
Q: For the aqueous [Hg14] complex K, -6.76 × 1029 at 25 °C. 2+ Suppose equal volumes of 0.0092 M Hg…
A:
Q: None
A:
Q: A) I B) II C) III D) IV 14) What is the major product of the following reaction? I © Ө (C6H5)3P-CH₂…
A:
Q: Determine if the following is aromatic, antiaromatic or nonaromatic:
A: Step 1: The aromaticity of the organic compound is based on the Huckel's rule. The Huckel's rule…
Q: how to synthesize this?
A: 1. First, we need to halogenate the alpha carbon (the carbon, adjacent to the carbonyl carbon)We…
Q: 2. Suggest two sets of conditions that would be needed to form the following cyclic ester (called a…
A: the mechanisms for the formation of tetrahydro-2H-pyran-2-one (lactone) from ethyl…
Q: Determine whether the following will proceed via SN1, SN2, E1 or E2 reaction. Draw the major…
A: The above reaction is a SN2 reaction .it cannot be a SN1 reaction because according to BREDTS rule…
Q: Identify and provide an explanation of what “Separation Science” entails and its importance with the…
A: Seperation science involves the separation of mixtures into their individual components for further…
Q: Step 3 Add two curved arrow(s) to draw step 3 of the mechanism: collapse of a charged tetrahedral…
A: Step 1: Step 2: Step 3: Step 4:
Q: CI CI 2. Br CI a. Draw a viable synthetic route for the following transformation showing all…
A: Step 1: **a) A viable synthetic pathway for the transformation:**Bromination:** Chlorobenzene, the…
Q: Calculate Boyle Temperature for hydrogen sulfide Select one: a. 125.9°C b. 1259°C C. 125.9K d. 1259…
A: Boyle Temperature is the temperature at which a real gas start to exhibit ideality (behaving as…
Q: a segment of dna has the following sequences of bases ATGCAATGATATTGAAGCTTA
A: The DNA segment you've provided, "ATGCAATGATATTGAAGCTTA," is composed of nucleotide bases. These…
Q: Consider this chemical reaction: ATP + H2O --> ADP+ Pi. Identify the FALSE statement regarding this…
A: Step 1:The FALSE statement regarding the given chemical reaction is:"It consumes energy." This…
Q: Draw a triacylglycerol (triglyceride) made from glycerol, myristic acid [CH3(CH2) 12COOH], palmitic…
A: Step 1: Step 2:
Step by step
Solved in 2 steps with 3 images
- Bromine reacts with alkenes in methanol according to the equation: - When this reaction was carried out with 4-tert-butylcyclohexene, only one isomer was formed with the molecular formula C12H23BrO (80% yield). Which of the following is the structure more reasonable for this compound?. Explain your reasoning through acorresponding mechanism.(b) Describe the hazards of (i) trioxygen: (ii) hydroxide ion; (ii) hydrogen sulfide. (c) Explain why an aqueous solution of sodium sulfide has an odor of hydrogen sulfide. (d) (11) Reduction of H,CCHCHO with NABH4 gives a product different from that of catalytic hydrogenation (H2 /Ni). What are the products?Provide the identity of the compounds in the reaction scheme shown in the photo:
- Chemistry 60. Give the principal product(s) expected, if any, when trans-1,3-pentadiene reacts under the following conditions. Assume one equivalent of each reagent reacts unless noted otherwise. (a) H2O, H3O+ (b) Na+EtO- in EtOH (c) Maleic anhydride heatCyclohexene reacts with bromine in the presence of NaI to yield -?Synthesize the following compound from benzonitrile (C6H5CN): Please don't provide hand written solution...
- What is the percent yield of the hydroboration oxidation of 1-octene to form 1-octanol? Original amount of 1-octene added 840 uL 2 mL of 1M borane THF added For oxidation 1.2mL of 3M NAOH and 1.2 mL of 30% hydrogen peroxide 2 mL of diethyl ether used for extraction 5.11g obtained as final product.Reaction of -pinene with borane followed by treatment of the resulting trialkylborane with alkaline hydrogen peroxide gives the following alcohol. Of the four possible cis,trans isomers, one is formed in over 85% yield. (a) Draw structural formulas for the four possible cis,trans isomers of the bicyclic alcohol. (b) Which is the structure of the isomer formed in 85% yield? How do you account for its formation? Create a model to help you make this prediction.Predict the products of the following reactions.(a) sec-butyl isopropyl ether + concd. HBr, heat
- (a) Tsomane and Nyiko were given a task of synthesising methylenecyclohexane 2. After a brief discussion with each other, Tsomane proposed Method A to synthesise 2 from cyclohexanone 1 while Nyiko proposed Method B that started from hydroxymethylcyclohexane 3. Each student believed that their proposed method is better than the other. (Scheme below) Ph THF A Ph Ph B H₂SO4 100 °C 3 OH (iii) In analysing both these methods, are there other possible alkene products other than methylenecyclohexane 2? Use mechanistic details to support your answer.Question: Which of the following is the major product from bromination of meta-nitrobenzenesulfonic acid? * Br Br2 , FeBra heat NO2 or or or NO2 NO2 NO2 NO2 B. D. (A) (B) Question: C6H5OCH2CH2Br is heated with Mg in ether and then quenched in cold H2O. What organic product will be obtained ? * C6H50CH2CH3 C6H50CH2CH2OH C6H50H C6H6Write the equations for the preparation of 1-bromobutane from :(i) 1-butanol (ii) but-l-ene