DNA Why was salt used in the extraction solution?

Q: Figure 9-22 shows the first steps in the process of making a DNA microarray, or DNA chip, using…

A: A DNA microarray is also known as the DNA chip, is the high throughput method that is used to trace…

Q: here were three main groups working to discover the structure of DNA. Who were the three different…

A: Taken in 1952, this image is the first X-ray picture of DNA, which led to the discovery of its…

Q: DNA hybridization process using probe

A: DNA Hybridization is the process of combining two complementary DNA single strands allowing them to…

Q: How would describe the observation of DNA precipitated out of the water-ethanol solution

A: Ethanol precipitation is a process where ethanol is used as an anti-solvent to purify and…

Q: why was glycerol added onto the total dna buffers?

A: The effect on DNA separation of adding glycerol to the running buffer was studied using linear…

Q: Describe and contrast the common steps of DNA replication in vivo and the PCR reaction in vitro? In…

A: DNA replication and Polymerase Chain Reaction are both processes that create copies of DNA. DNA…

Q: Restriction enzymes bind to specific sequences of DNA to seal them together. True False

A: Restriction enzymes bind to speffic sequence of DNA seal them together. This is TRUE. Restriction…

Q: samples Marker B 1,200 bp 1,000 bp 900 bp 800 bp 700 bp 600 bp s00 bp 400 bp 300 bp 200 bp 100 bp…

A: The given diagram is a representation of the process of gel electrophoresis. It is a laboratory…

Q: COMPLEMENTARY

A: COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC is given below

Q: DNA QUANTITATION Why is a reagent blank (containing no nucleic acids) is taken prior to measuring…

A: DNA QUANTITATION

Q: Please draw the structure of DNA and label the parts. Thank you very much for your help

A: Deoxyribonucleic acid (DNA): DNA is a type of molecule known as nucleic acid. It is the blueprint…

Q: give the significance/role/effect of the reagent/condition in the isolation or analysis of a…

A: Deoxy ribonucleic acid (DNA) is the genetic material of the cell which carries the information on…

Q: Identify the solution component that contains the extracted DNA.

A: Ethanol precipitation method is generally used for DNA extraction.

Q: Using this strand of DNA (TACAACTGA), show what a deletion and insertion would look like”

A: Nucleotides are subunits of DNA, and each nucleotide is made of a sugar molecule called deoxyribose,…

Q: •DNA structure •DNA isolation •DNA isolation methods DNA purification urifi

A: DNA, or deoxyribonucleic acid, is the genetic material in people and in other remaining life forms.…

Q: What are the roles of the following reagents in DNA extraction? a. Ethanol b. NaCl c. SDS d. TE…

A: A) The initial role of the ethanol and monovalent cations is to remove the solvation shell…

Q: Justify why the absorption of UV light by double-stranded DNA rises when the DNA is denatured (the…

A: Hyperchromicity is the result of a molecule's increased absorbance.

Q: Describe the characteristics of the extracted DNA, such as colour, shape, size, and consistency.

A: Deoxyribonucleic acid (DNA) is a genetic information-encoded molecule. This information is used to…

Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…

A:

Q: Sall Kpnl Kpnl 450 600 200 400 1650 1. If you were to subject this digested DNA to agarose gel…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: . DNA polymerase requires both a template, to be copied, and a primer, which provides a 3' hydroxyl…

A: The process of DNA synthesis occurs in all of the living organisms and serves as a base for…

Q: EboV from Guinea pig Reference DNA Sample            mRNA           Protein

A: The tiny living creatures such as bacteria, viruses, fungus, algae, and protozoa have a significant…

Q: Why do we need to add “COLD” alcohol? What is the effect of the temperature of the alcohol in the…

A: DNA is extracted from various sources to study the sequence of the DNAs from various sources and to…

Q: Question Which of the following activities of DNA pol lis MOST important in proofreading A 5' to 3'…

A: The DNA replication in the newly added base are read by DNA pol I  enzyme to check weather the added…

Q: N

A: Recombinant DNA , molecules of DNA from two different species that are inserted into a host organism…

Q: Design primers for PCR that would be able to amplify this entire DNA fragment.  -Design the primers…

A: AThe primer sequence is as follows: FORWARD PRIMER: 5' GCTCAGG 3' REVERSE PRIMER: 5'TCTATTA3'

Q: nce of Bacteriophage.

A: The Significance of Bacteriophage:

Q: The difference between a template and a primer?

A: The DNA (deoxyribonucleic acid) is the genetic material of an organism The genes consist of the DNA…

Q: Transformation and sequence validation of the clones

A: DNA cloning is a technique of molecular biology. It is used to generate identical copies of a piece…

Q: Which lane shows the DNA fragment completely digested with Pst n

A: Restriction endonuclease are the enzymes which cleave the DNA at specific sites  Various sites are…

Q: Ruwaifa want to compares a nucleotide query sequence what option he will opt in BLAST and why?

A: BLAST is Basic local alignment search tool used to compare the queries in a DNA database. They are…

Q: Blue prints of body design are stored in the DNA. Why?

A: Genetic material is the medium through which genetic information passes from a parent cell to its…

Q: sequence PCR

A: PCR or Polymerase chain reaction is a method to apply to make billions of copies of specific DNA…

Q: What compounds remain in the ethanol solution after the DNA is removed bt spooling onto a glass rod?

A: Introduction:  The extraction of DNA is the first step for subsequent molecular or forensic…

Q: DNA could be denatured without maximum damages a. NaCl b. High heat c. NaOH d. Na-acetate

A: The process of separation of double stranded DNA (dsDNA) into single strands by physical or chemical…

Q: Aside from gel electrophoresis Give another method to quantify DNA. Explain the concept behind this…

A: DNA quantification is a type of quantification of nucleic acids that is used for the determination…

Q: Some recombinant DNA techniques depend on the specific hybridization (or annealing) between two…

A: The invention of recombinant DNA technology was carried out by Herbert Boyer & Stanley & N.…

Q: Protocols for analysing DNA

A: *DNA can be analysed through  Polymerase chain reaction Short tandem repeat analysis Y chromosome…

Q: Numbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will…

A: BamHI is a type II restriction endonuclease that can recognize short DNA sequences (6 bp) and cleave…

Q: How we prepared the sample of DNA and what kinds of tracking dye we add to sample in SDS-PAGE ?…

A: INTRODUCTION SDS PAGE or Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis is a technique…

Q: All the DNA extraction protocols suggest adding salts to the extraction buffer. What is the role of…

A: * Dna extraction can be done in following steps  Breaking cells to release the DNA  Separating DNA…

Q: What are the possible errors that could have occurred in the experiment of extracting the DNA.

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule. DNA replication is the process by which…

Q: DNA hybridization process and probe usage

A: 20 to 50 base pair length, small, single strands DNA used to find a specific gene in long genome is…

Q: Chargaff determined the base composition of DNA from a variety ofdifferent sources.What information…

A: Introduction DNA is the genetic material whose structural unit is nucleotides. Each nucleotide…

Q: Much of the human genome consists of repetitious DNA. Describe the difference between microsatellite…

A: Some of the similarities between microsatellite and minisatellite are that both are type of tandem…

Q: If insert DNA was obtained by PCR using Taq DNA polymerase, what shape does the end of this DNA…

A: Taq polymerase is basically a thermostable polymerase that is obtained from the bacteria called as…

Q: Given the electrophoresis profile of a Sanger sequencing result, what was the sequence of the…

A: The correct option is b 5'CCATTGG3'. Sanger sequencing ( method of DNA sequencing and it involves…

Q: . What information about the structure of DNA wasobtained from X-ray crystallographic data?

A: The deoxyribonucleic acid (DNA) is a hereditary material that is found in almost all living…

Q: Why is sodium acetate used in DNA precipitation by ethanol, rather than sodium chloride? (Hint –…

A: DNA precipitation - DNA precipitation is a process in which nucleic acids are precipitated out with…

Hematology

Hematology is the branch of biology. Hematology is the medical field that deals with the treatment of blood disorders and cancers, such as hemophilia, leukemia, lymphoma, and sickle-cell anemia. Hematologists and hematopathologists are medical professionals who specialize in illnesses of the blood and its components.