Question Which of the following activities of DNA pol lis MOST important in proofreading A 5' to 3' exonuclease B polymerase activity ligation activity 3' to 5' exonuclease
Q: During Anaphase chromosomes separate and move to ends of the cells. True False
A: During mitosis and meiosis , there are generally 4 phases:- Prophase Metaphase Anaphase…
Q: What is the difference between the two salt precipitation methods: salting in and salting out?…
A: The solubility of a protein in solution depends on the concentration of the salt present in…
Q: What is the role of decarboxylation in fatty acid synthesis? Describe another process discussed in…
A: Fatty acids are the body's fat-building blocks. Acetyl-CoA is used to make fatty acids. Fatty acid…
Q: Explain in complete manner why these 3 became the major pathway that eventually become the entry…
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic…
Q: rans configuration) (3) linoleic (18:2) (4) stearic (18:0) (5) palmitic (16:0) 5 >…
A: The melting point of fatty acid was influenced by the degree and length of the hydrocarbon chain.…
Q: Briefly describe the primary structure of collagen, a- keratin and B-keratin.
A: Proteins are biomolecules and macromolecules that are made up of one or more long chains of amino…
Q: Enhancer sequences may be very far from the genes they affect but they are always upstream of the…
A: Enhancer sequence : These are regulatory DNA sequences, when these are bound by transcription…
Q: As the strands are synthesized in replication, which of the following is true? the leading strand…
A: Replication:- process of formation of replica's of DNA in a semiconservative manner. Bidirectional…
Q: Which among the following statements is correct? O lon-exchange chromatography is dependent on the…
A: Introduction: Chromatography is an analytical technique for the separation of different dissolved…
Q: Which steps below require an ATP to run?
A: "Since you have asked multiple questions, we will solve the first question for you. If you want a…
Q: tline the first round of lipid catabolism using a C18 saturated fatty acid. Indicate cofactors and…
A: The beta-oxidation of the fatty acids occurs in the mitochondria, it involves the sequential removal…
Q: Which of the following viruses have been used as vectors for gene delivery?
A: Gene delivery is a process of introducing the foreign genetic materials which are DNA and RNA into…
Q: What term is typically used to describe gene systems that respond to the supply of a required…
A: These terms are generally used in operon models. An operon is a unit of bacterial gene expression…
Q: Which of the following statements describes one reason that plant oils are generally healthier for…
A: Plant oils, or vegetable oils, are derived from plant sources. There are three different types of…
Q: draw the full equation for this triacylglycerol undergoing saponification, using KOH.
A: In the process of saponification, triglycerides are reacted with sodium or potassium hydroxide to…
Q: What is the process in which antibodies attach to antigens, causing the formation of masses of…
A: Because the Y-shaped antibody arms randomly attach to many surfaces of non-self red blood cells,…
Q: Sphingolipids do _________________. I. contain a glycerol core with a phosphocholine…
A: Glycerophospholipids and sphingolipids are complex lipids. They're present in biological membranes…
Q: Label the N-terminal and the C-terminal in the above peptide.
A: The amino acid residue on one end of a peptide molecule does have an amine group on the alpha…
Q: Consider each of the following disaccharides: a) Label the acetal and hemiacetal in each…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: . Using electron flow arrows, show electron transfer from nadh to fmn in complex 1 of the electron…
A: The electron transport (ETC) chain is coupled with ATP synthesis. ETC occurs in Cristea…
Q: Match general features of each blood groups in column A with the blood types in column B.…
A: Blood Group A- Contains N-acetyl glucosamine Blood group B - Contains galactose Blood group O-…
Q: Is proteus vulgaris positive or negative in lia test? Why?
A: Proteus vulgaris is a gram negative bacteria that test positive for indole and catalase production.…
Q: Different types of mutations and how to use the genetic code table.
A: Mutations are described as the changes that occurs in the sequence of DNA. Mutations can occur from…
Q: Tube Tube Tube Tube Tube Tube Tube Tube Tube Tube 4 7 8. 10 .1 .01 .001 .0001 x10 x10 x10 x108 x109…
A: Given Values: The dilution factor in each tube from the previous one is 1/10. It means the dilution…
Q: From a hospital patient affected with a mysterious illness, cells were isolated, cultured and…
A: In human and all almost organisms, DNA or deoxyribonucleic acid is the hereditary material. DNA is…
Q: Which of the following are nonessential amino acids in humans? valine aspartic acid proline…
A: Amino acids are monomers of protein they are linked with each other by forming peptide bonds.…
Q: 5. Salivary a-amylase cleaving a(1 example for which type of specificity? a) Group specificity b)…
A: Group specificity : Enzyme will catalyze the reaction on a function group of different molecules…
Q: Which of the following levels of protein structure can involve covalent bond formation? A) Primary…
A: The structure of a protein is organized in four levels of organization: primary, secondary, tertiary…
Q: Write the following oligopeptide using the one letter code for the amino acids: Cys-His-lle-Leu-Glu…
A: One letter code has been assigned to each and every amino acids and is often used to represent the…
Q: topic: sds-page gel If APS is not available, what other chemicals can be used alternatively to…
A: APS stands for Ammonium Persulfate. It is an oxidizing agent that is used along with TEMED in order…
Q: In the RBCs of the patient in the picture, which of the following would be expected? Explain. A.…
A: Red blood cells (RBCs) are the blood cells, which help to carry oxygen from the lungs to the tissues…
Q: In the case of autosomal recessive mutations, the frequency of the disease in a population is…
A: Autosomal recessive inheritance It is a particular way of genetic trait or condition which can be…
Q: mg/L of cell tissue and 10 mg/L of ammonia
A: TKN is refers to the term Total Kjeldahl Nitrogen which is defined as the total concentration of…
Q: (a) Identify a phospholipid from the list of compounds shown above. __________ (b) Identify a…
A: Answers: (a) Identify a phospholipid from the list of compounds shown above. __________ Answer:…
Q: Consider 41 NADH and 19 FADH, molecules funneling electrons into the electron transport chain…
A: Oxidative phosphorylation is the end point of energy-yielding metabolism in aerobic organisms. It…
Q: In the space below, draw the structural diagram of the molecule that hexokinase phosphorylates into…
A: Glycolysis is a metabolic mechanism and anaerobic energy source found in practically all living…
Q: Сно сно CH,OH Fo но H- HO- H- Phosphorogluco- isomerase Phosphofructo- kinase Нехоkinase но H- но…
A: The given pathway represents the glycolytic pathway, through which the glucose molecules are…
Q: Unsaturated fatty acids have ----. Question 16 options: multiple amide groups in their…
A: Fatty acids are the simplest form of lipids and serve as constituents in a large number of complex…
Q: 1. The following lipids are important structural components of the cell membrane of fish. Draw the…
A: The membrane phospholipids have a glycerol backbone.
Q: Which of the following enzyme is responsible for the regulation of biological nitrogen fixation? A.…
A: Nitrogen fixation is biochemical process by which molecular form of nitrogen with triple covalent…
Q: How would you develop an assay for soybean trypsin inhibitor and use it to test products??
A: Trypsin inhibitor: Also known as serine protease inhibitor i.e serpins inhibitors control the…
Q: LLNSAMSRLYSLRSS 1.Assuming this sequnce is enitrely alpha helical what is the hydrogen bond donor…
A: The α-helix is an ordered secondary conformation of proteins. An α-helix is stabilized by the…
Q: I'm working on the thermodynamics of protein binding but I want to understand more on the enthalpic…
A: Introduction Protein folding and protein-ligand interaction are basically thermodynamically driven…
Q: 1) Given the structure of pyruvate below, draw the reaction with NADH to form lactate. (only the…
A: Pyruvate is the end product of the glycolytic pathway. Under aerobic condition, the pyruvate…
Q: Lipids may originate through carbocation-based condensation of thioesters or by carbanion-based…
A: Lipids are a class of compounds that are insoluble in water and soluble in non-polar solvents.…
Q: Illustrate the biosynthetic pathway of resin 2. Give 5 industrial uses of resins
A: Resins : Resins are the amorphous products on complex chemical nature. These are usually…
Q: 1. In human diet, all cholesterol comes from Animal products Vegetable products Both A and B None of…
A: "Since you have posted multiple question we will answer the first question for you. If you want any…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: Lipids are water-soluble substances that tend to form surface monolayers or micelles.
A: Lipids are a class of molecules which have very poor water solubility, by definition. So, the…
Q: value the cathode or anode). Protein eins wards Pepsin Lysozyme Hemoglobin Mynolohin IpH 1.0 11.0…
A: On basis of the gel used, electrophoresis is classified into 2 types, Agarose gel…
Step by step
Solved in 3 steps
- Question 11 Each cycle of amplification in PCR involves all of the steps EXCEPT: A) annealing of oligodeoxyribonucleotide primers to DNA. B) the addition of fresh dNTPs to the reaction mixture. C reaction with DNA polymerase at approximately 70°C. D) thermal denaturation of the target duplex DNA.Question 5 Review Figure 21.6 types of DNA sequences in the human genome. The lowest percentage of human genome O repetitive DNA related to transposable elements and related sequences (L1 sequences and Alu elements) O repetitive DNA unrelated to transposable elements (simple sequence and large-segment duplications O unique noncoding DNA O introns O exons O regulatory sequencesQUESTION 21 Choose each of the characteristic(s) of all RNA polymerases from the list below. A. elongation adds new ribonucleotides to the 3-OH B. requires a primer to initiate synthesis C. have 3' to 5' exonuclease activity D. adds nucleotides based on sequence complementarity to a template E. have 5' to 3' polymerase activity O F. elongation adds new ribonucleotides to the 2'-OH G. have 3' to 5' polymerase activity
- Question 30 Which of the following correctly describes a difference between RNA & DNA polymerases? (A) RNA polymerases usually do not need a template, while DNA polymerases do. B DNA polymerases usually require a primer while RNA polymerases do not. RNA polymerases usually synthesize introns, while DNA polymerases synthesize cistrons. D RNA polymerases polymerize 5' –> 3', while DNA polymerases polymerize 3' –> 5'.Question 4. Given the probability that a restriction enzyme will cut DNA if the recognition sequence for the enzyme is 5'-GGATCC-3' and the GC content is 60%, c) Which of the following will lead to DNA cutting more frequently? Choose all that apply. O Increasing the AT content to 60% O Using a seven base cutter with the sequence 5'-GGATCCC-3' O Using a five base cutter with the sequence 5'-GGACC-3' O Increasing the GC content to 70% O Decreasing the GC content to 50%Question 16 Advantages of using the PCR include the following EXCEPT A it will always give the desired product B it can target desired sequences from either genomic or cDNA templates (C) the reaction is specific to a desired DNA sequence (D) only small amounts of template are needed
- Question 19 The polymerase chain reaction requires the following except A primers complementary to the ends of the sequence to be amplified B) carefully controlled temperature conditions cycles of denaturation, annealing and extension RNA polymerase to synthesize RNA primersQuestion 12 Which of the following DNA pol I activities would be MOST important in the removal of the primer? A 3' to 5' exonuclease activity B 5' to 3' exonuclease activity polymerase activity D) ability to nick both strands of the DNAQuestion 8 The cloning a eukaryotic gene in a bacterial plasmid does not include extension gene inserted into a cloning vector such as a plasmid The vector is obtained by bacterial cells. O Host cells grown in culture to form a clone of cells containing the "cloned gene of interest" O formation of a recombinant DNA
- QUESTION 19 Which of the following is/are true regarding next generation sequencing? Next generation sequencing is also known as 'sequencing by synthesis' Next generation sequencing uses ddNTPS to identify the base at the end of a nucleotide chain Next generation sequencing will NOT work if chain terminating nucleotides are included in the reaction Next generation sequencing uses fluorescently labeled ddNTPs instead of radioactively labeled ddNTPs Next generation sequencing allows hundreds of millions of DNA fragments to be sequenced at the same time QUESTION 20 tick Save and Submit to save and submit. Click Save All Answers to save all answers.Question 14 Why are long reads the preferred method to sequence repetitive elements? Select the statement that is FALSE. ◇ If a repetitive region is longer than 300 basepairs (the length of a short read) it's impossible to determine the total length. O Long reads are more likely to span repetitive regions on either side, making it easier to map the repetitive regions. O It's hard to determine where short reads should be placed, as they could map to multiple repetitive regions. O Long reads are less error prone and thus better for sequencing overall. Question 15 Which of the following statements is NOT true about GWAS? When identifying alleles associated with a disease, we compare the frequency of an allele in a control group versus a cash groupQuestion 4. What is the probability that a restriction enzyme will cut DNA if the recognition sequence for the enzyme is 5'-GGATCC-3' ? b) Assuming that the % GC is = 60%. O (2/10)4 (3/10)² O (3/10)4 (2/10)² O (1/6)4 O (1/4)6 O (6/10)4 (4/10)2