Answered: Justify why the absorption of UV light…

Justify why the absorption of UV light by double-stranded DNA rises when the DNA is denatured (the hyperchromic effect).

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: Why does heat denature, or melt, DNA in solution?

A: DNA or deoxyribonucleic acid is the genetic material of most of the organisms except RNA viruses. It…

Q: What do you mean by DNA polymerase δ?

A: Introduction: DNA polymerase δ is one of the multiple types of DNA polymerases found in eukaryotes.

Q: the role of DNA ligase I.

A: Answer. DNA ligases are the enzymes that are required by all organisms to sustain the structural…

Q: explains how the underwinding of a B-DNA helix might facilitate or stabilize the formation of Z-DNA

A: Dideoxy ribonucleic acid (DNA), ribonucleic acid (RNA), and proteins play an essential role in the…

Q: true or false: DNA polymerase III performs nick translation.

A: Nick translation is a process of modifying a polynucleotide sequence to a new sequence by replacing…

Q: Question 10. After liquid atomization (nebulization) of DNA, it is necessary to repair the ends of…

A: Nebulization is a process of fragmenting DNA into smaller pieces by exposing it to a high-pressure…

Q: Ultraviolet light can cause covalent linkages between consecutive pyrimidine bases in DNA (up to 100…

A: The question is asking about the DNA repair system that is most effective in correcting the errors…

Q: true or false: During replication, template strands of DNA are read in the 5’ to 3’ direction.

A: Solution:- DNA polymerase enzyme helps in the synthesis of DNA molecules from deoxyribonucleotides,…

Q: why DNA polymerase cannot remove all the RNA primers from Okazaki fragments to form a lagging…

A: Replication is the process by which cells create copies of their genetic material, DNA. DNA…

Q: d). It's the temperature at which the mass of single stranded DNA equals the mass of double stranded…

A: Option d is NOT a correct description of the DNA melting temperature for a system in which we have…

Q: Having the ability to degrade the DNA allows the DNA polymerase to perform its job properly and…

A: DNA replication is a complex process of producing copies of the entire chromosome using the…

Q: DNA ligase

A: The correct option is Option 3. DNA ligase

Q: DNA is subjected to alteration on daily basis. Provide an account of all these changes.

A: Each day within the body there are several changes that occur in response to the environment and the…

Q: DNA polymerase functions from 5’ to 3’ direction. Explain this sentence. You

A: The DNA has been unraveled and unzipped. The helical structure has been unraveled. Special chemicals…

Q: The important excision mechanism that repair DNA damage induced by UV light are called Base excision…

A: The above given statement is false . It is not known as base excision repair . The statement given…

Q: Describe the Okazaki fragment and its formation in one of the strands of DNA essentiality of their…

A: Only while each strand of DNA is separated from an additional can DNA polymerase activity continue…

Q: Contrast the various types of DNA repair mechanisms known to counteract the effects of UV radiation.…

A: A variation is an adjustment in a DNA grouping. Changes can result from DNA duplicating botches made…

Q: If DNA synthesis occurs without error, the resulting double-stranded DNA is an exact copy of the…

A: DNA synthesis is a process in which a double-stranded DNA molecule is created from two…

Q: true or false: Hydrophobic interactions between bases are the primary stabilizing forces responsible…

A: The double helix is a structure formed by two strands of DNA that wind around each other. The…

Q: Cells exposed to ultraviolet light develop thymine dimers. Some organisms use visible light to…

A: When there is prolonged exposure to UV light, the DNA sequence forms the thymidine dimer, which…

Q: Cells exposed to ultraviolet light develop thymine dimersand visible light reverses this damage.…

A: Irradiation by the UV light causes pyrimidine dimers. The most common pyrimidine dimers formation is…

Q: When DNA is replicated, two new DNA double helices areformed, each consisting of one parental strand…

A: Introduction DNA replication is very crucial for the continuation of life as every new daughter…

Q: Elaborately explain how DNA lagging strand synthesis takes place

A: BASIC INFORMATION DNA It stands for deoxyribo nucleic acid. It is the genetic material of all…

Q: Suppose a mutation occurs in a cell such that normal Okazaki fragments were created during DNA…

A: DNA helicase, is an enzyme that separate double-stranded DNA into single strands allowing each…

Q: DNA polymerases add a deoxyribonucleotide triphosphate to the 5' hydroxyl group of a growing DNA…

A: DNA replication is the process by which a cell makes an identical copy of its DNA before cell…

Q: Replication of a circular DNA molecule can occur by either theta () replication or by rolling…

A: Introduction :- Plasmids are tiny circular DNA molecules with a few to over one hundred genes. The…

Q: DNA pol III synthesizes the leading strand as a continuous strand. The lagging strands are…

A: DNA, deoxyribonucleic acid is a double helical molecule present in the cell which carries genetic…

Q: Deficiencies in the activity of either dUTPase or DNA ligase stimu- late recombination. Why?

A: dUTPase- a dUTP diphosphatase is an enzyme that catalyses the chemical reaction dTUP+H2O/…

Q: . DNA polymerase requires both a template, to be copied, and a primer, which provides a 3' hydroxyl…

A: The process of DNA synthesis occurs in all of the living organisms and serves as a base for…

Q: Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the…

A: Replication is the process of synthesis of new strands of DNA from the parental DNA molecule and it…

Q: A person with deficient or abnormal ligase may have an increased cancer risk and chromosome breaks…

A: Enzymes are essential biocatalysts for all living cells. Enzymes carry out various functions in the…

Q: In experiments using polymerase chain reactions (PCR), it is often more difficult to amplify through…

A: Introduction :- Polymerase Chain Reaction (PCR) is a laboratory technique used to make many copies…

Q: An Investigator obtains a bacterial temperature-sensitive mutation that affects a step in the…

A: Most of the replication enzymes are proteinaceous in nature. The structure of a protein is formed by…

Q: Question 2 Which of the following is FALSE about RNA polymerase II: O Le DNA polymerase, it…

A: RNA polymerase I is an enzyme responsible for the transcription of ribosomal RNA (rRNA) in…

Q: DNA mismatch repair enzymes preferentially repair bases on the newly synthesized DNA strand, using…

A: DNA mismatch repair enzymes play an important role in maintaining the accuracy of DNA replication.…

Q: What is the melting temp. of the following double-stranded DNA fragment…

A: Melting temperature formula : Tm = 4* (G+C) + 2 * (A+T) Number of G+C = 6 Number of A+T = 20

Q: In the DNA extraction. What is the role of alcohol in the DNA extraction process?

A: DNA extraction involves collecting all the DNA from a cell. For that, we first prepare the cells…

Q: All of the following contribute to a low mutation rate EXCEPT a. high fidelity of DNA polymerase…

A: A mutation is a change in the DNA sequence of a gene, chromosome, or entire genome. This can result…

Question

Justify why the absorption of UV light by double-stranded DNA rises when the DNA is denatured (the hyperchromic effect).

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

At 260 nm what component of DNA absorbs at this nm(hydrogen bond, phosphate backbone, nitrogenous base, deoxyribose).
AGE can be used to separate DNA based on its size alone due to which factor? non-interacting agarose molecules O negatively charged DNA molecule constant mass-to-charge ratio of DNA constant voltage and agarose concentration
What is the melting temp. of the following double-stranded DNA fragment CATCGCGATCTGCAATTACGACGATAA GTAGCGCTAGACGTTAATGCTGCTATT
The correct option is D. But I want you to explain why the other options are incorrect. Thanks
The drug Ciprofloxacin hydrochloride (Cipro) blocks bacterial DNA gyrase enzyme needed to counteract excessive twisting of DNA that occurs when circles of DNA are unwound to be copied into DNA or RNA. Why doesn’t this drug kill human cells?
Restriction sites of Lambda (A) DNA - In base pairs (bp) The sites at which each of the 3 different enzymes will cut the same strand of lambda DNA are shown in the maps (see figure 3 B-D), each vertical line on the map is where the respective enzymes will cut. A DNA A (bp) 48502 10 000 20 000 30 000 40 000 9162 17 198 B Sal I 7059 14 885 28 338 35 603 42 900 (bp) Hae III 11 826 21 935 29 341 38 016 (bp) 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864 Figure 3: Restrictrion site map showing the following A) inear DNA that is not cut as reference B) DNA CLt with Sal L C) DNA cut with Hae , D) DNA cut with Eco RI 1. Calculate the size of the resulting fragments as they will occur after digestion and write the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp (see figure 3A). Page 3 of 7 9162 17 198 Sal i (bp) 7059 14 885 28 338 35 603 42 900 Hae I (bp) 11 826 21 935 29 341 38 016 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864
Guanine was oxidized into 8-oxoguanine, which process below will ensure the integrity of the DNA? O Oxidative demethylation O Nucleotide-excision repair OSOS response O Base-excision repair
DNA polymerase
A spontaneous deamination of cytosine to uracil in DNA occurs at a rate about 100 bases per cell per day. Explain the DNA repair mechanistic steps that can remove uracil and repair the DNA break.
True or false: During DNA replication, the DNA template is read 3 ́ to 5 ́ by a DNA polymerase, as the DNA polymerase adds nucleotides to the growing strand 5 ́ to 3 ́?
true or false: DNA polymerase I is the main polymerase enzyme involved during elongation.