DNA from a strain of Bacillus subtilis with genotype a + b + c + d + e + is used to transform a strain with genotype a – b – c – d – e – . Pairs of genes are checked for co-transformation and results shown below are obtained. Based on these results, what is the order of the genes on the bacterial chromosome? Show how you work out the order by diagraming.

DNA from a strain of Bacillus subtilis with genotype a + b + c + d + e + is used to transform a strain with genotype a – b – c – d – e – . Pairs of genes are checked for co-transformation and results shown below are obtained. Based on these results, what is the order of the genes on the bacterial chromosome? Show how you work out the order by diagraming.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter17: Bacterial And Viral Genetics

Section: Chapter Questions

Problem 1ITD

See similar textbooks

Similar questions

The following recombinants are recovered when conjugation occurs between an a+d+g+ donor and an a d'g recipient. at dt g+= 84% ad g+= 6% at dg+ = 10% ad g+= less than 1% What is the map distance between the a and d genes? 6 map units less than 1 map unit 10 map units 84 map units 74 map units
E. coli cells are simultaneously infected with two strains of phage λ. One strain has a mutant host range, is temperature sensitive, and produces clear plaques (genotype h st c); another strain carries the wildtype alleles (genotype h+ st+ c+). Progeny phages are collected from the lysed cells and are plated on bacteria. The following numbers of different progeny phages are obtained: Progeny phage genotype Number of plaques h+ c+ st+ 321 h c st 338 h+ c st 26 h c+ st+ 30 h+ c st+ 106 h c+ st 110 h+ c+ st 5 h c st+ 6 a. Determine the order of the three genes on the phage chromosome. b. Determine the map distances between the genes. c. Determine the coefficient of coincidence and the interference
In the Western blot shown here, proteins were isolated from redblood cells and muscle cells from two different individuals. Oneindividual was unaffected, and the other suffered from a diseaseknown as thalassemia, which involves a defect in hemoglobin. Theblot was exposed to an antibody that recognizes β globin, whichis one of the polypeptides that constitute hemoglobin. Equal totalamounts of cellular proteins were added to each lane. Explain these results.
In a transformation experiment involving a wild type bacterial strain with a recipient strain with mutations in genes f, g, h and i pairs of genes were analyzed for co-transformation with the following results: Gene Pair Co-transformation g+ i+ f+ i+ yes no f+ h+ Уes f+ g+ no g+ h+ h+ i+ no уes What is the linear order of these genes relative to cach other?
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
During conjugation, HFR; F+ function as DNA donors and function as DNA recipients. F+; F- F-; F+ F-; HFR
In a genetics lab, Kim and Maria infected a samplefrom an E. coli culture with a particular virulent bacteriophage. They noticed that most of the cells werelysed, but a few survived. The survival rate in theirsample was about 1 × 10−4. Kim was sure the bacteriophage induced the resistance in the cells, whileMaria thought that resistant mutants probably alreadyexisted in the sample of cells they used. Earlier, for adifferent experiment, they had spread a dilute suspension of E. coli onto solid medium in a large petri dish,and, after seeing that about 105colonies were growingup, they had replica-plated that plate onto three otherplates. Kim and Maria decide to use these plates totest their theories. They pipette a suspension of thebacteriophage onto each of the three replica plates.What should they see if Kim is right? What shouldthey see if Maria is right?
Draw a diagram/figure to explain the conjugation process (e.g. use PowerPoint or draw one by hand and include a photo of it). You should include in the diagram the F- recipient, Hfr Donor and the transconjugant/recombinant recipient. Make sure to include the genes encoding for Leucine, Threonine, Thiamine and Streptomycin resistance in your diagram. How does an Hfr strain of coli transfers chromosomal DNA to an F- strain? What determines how much of the chromosomal DNA is transferred?
In E. coli, four Hfr strains donate the following markers,shown in the order donated:Strain 1: M Z X W CStrain 2: L A N C WStrain 3: A L B R UStrain 4: Z M U R BAll these Hfr strains are derived from the same F+ strain.What is the order of these markers on the circularchromosome of the original F+?
An Hfrstrain that is a *b*c*d* e*f* g *h* is mated with an F strain that is a b e d e f gh. The mating is interrupted at 5 minutes interval, and the genotypes of the F recombinants are determined. The results obtained are tabulated in Table 2. Draw the map of the Hfrchromosome and indicate the position of the origin of transfer, the direction of the transfer and the minutes between genes. Table 2:Entry time of Hfr chromosome into recipient cell. Time a d e f h 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
By conducting conjugation experiments between Hfr and recipientstrains, Wollman and Jacob mapped the order of many bacterialgenes. Throughout the course of their studies, they identified severaldifferent Hfr strains in which the F-factor DNA had been integratedat different places along the bacterial chromosome. A sample of theirexperimental results is shown in the table:Draw a map that shows the order of genes and the locations ofthe origins of transfer among these different Hfr strains?
Acridine orange is a chemical that inhibits the replication ofF- factor DNA but does not affect the replication of chromosomalDNA, even if the chromosomal DNA contains an Hfr. Let’s supposethat you have an E. coli strain that is unable to metabolizelactose and has an F factor that carries a streptomycin-resistantgene. You also have an F− strain of E. coli that is sensitive to streptomycinand has the genes that allow the bacterium to metabolize lactose. This second strain can grow on a lactose-containing medium.How would you generate an Hfr strain that is resistant tostreptomycin and can metabolize lactose? (Hint: F factors occasionally integrate into the chromosome to become Hfr strains, and occasionally Hfr strains excise their DNA from the chromosome to become F+ strains that carry an F′ factor.)