Q: Which process divides a cell's nucleus and nuclear material?
A: Introduction :- In terms of genomics, a nucleus is the organelle within a cell that is…
Q: st the classification of fatty acids based on their chemical structures, as well as their synthesis…
A: Fatty acids are the building blocks of fats. These maybe either saturated or unsaturated which have…
Q: When two molecules of glucose go through glycolysis, how many molecules of pyruvate are formed? a.…
A: Please follow step 2 for detailed explanation.
Q: Besides using A. tumefaciencs in the generation of transgenic plants, elaborate on the THREE (3)…
A: Agrobacterium tumefaciens, a gram negative bacteria that is used to perform horizontal gene transfer…
Q: This image shows the alignment of the promoter from the same gene (gene H) across multiple mammalian…
A: Introduction The central promoter region of genes in archaea and eukaryotes contain a DNA sequence…
Q: In about 300 million Americans, 30,000 have cystic fibrosis, how many are carriers?
A: According to the Hardy-Weinberg equilibrium allele and genotype frequencies will remain same…
Q: Which force of evolution is primarily at work in humans today?
A: Evolution is a continuous process involving change, this change is necessary and allows the organism…
Q: Out an outbreak investigation for communicable diseases is key in disease prevention. Examine the…
A: A communicable disease is one that transmits from one person or animal to another. These diseases…
Q: How many NADH, FADH2, NADPH and ATP will be generated when breaking this fatty acid down into…
A: Fatty acids are broken down into acetyl-CoA by beta-oxidation within the mitochondrial matrix and…
Q: A scientific theory is an explanation that has been published in journal or a book. predicts what…
A: Introduction A well considered explanation for observations of the natural world that has been…
Q: How do Southern blotting, Northern blotting and Western blotting
A: in genetically modified organism all above three specific separation technique are used for genes…
Q: explain the evaluation criteria that would be used to check for the goodness of your solution to the…
A: There are a few important points about Ebola Virus : They belong to the virus of Filoviridae, virus…
Q: It is often stated that excess mortality (in general) is higher in low socioeconomic populations.…
A: Mortality rate It is a measurement of the number of deaths (or deaths related to a particular cause)…
Q: 9. which of the following is an example of quantitive data? A)the freshman class of the students…
A: Introduction:- data represent the various types of discrete values which provides information about…
Q: Use the following information to answer the next question. Meiosis. Chromosome Content of Human…
A: The process of combining the male gamete, or sperm, with the female gamete, or ovum. The product of…
Q: yruvate dehydrogenase kinase-4 (PDK-4) is a widely expressed isoform of PDK and is responsible for…
A: CRISPR stands for clustered regularly interspaced palindromic repeats is a genetic engineering…
Q: Discuss the steps you would proceed after selecting your E. coli strain to prepare competent cells…
A: c) We can select the E. coli DH5α cells to prepare competent cells for cloning. The steps for the…
Q: Is a chromosomes a one half of a newly replicated eukaryotic chromosome
A: The eukaryotic chromosomes consist of a DNA-protein complex that is organized in a compact manner…
Q: What is the advantage to an organism in using aerobic cellular respiration compared to the anaerobic…
A: Cellular respiration is the process by which the biological fuels are oxidised in the presence of an…
Q: Why
A:
Q: Numerous hair-like structures extend from the cell membrane of the following type of tissue: O a.…
A: All of the body's interior and external surfaces are covered by a type of tissue called epithelium,…
Q: Write the cross using correct symbols. What kind of cross is this called?
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: 5. Which base sequence of a DNA molecule produces a codon on an mRNA molecule that will allow the…
A: A DNA strand can be trancribed to form mRNA molecule which is again translated to produce a sequence…
Q: a) Which strand is coding strand? b) What is the sequence of the encoded polypeptide? A mutant…
A: The central dogma of molecular biology involves the synthesis of a polypeptide chain of amino acids,…
Q: heightened responses to ethanol, and ken&barbie (kb) lack external genitalia. [These are real genes…
A: The technique of pinpointing a gene's position on a chromosome is known as gene mapping. The most…
Q: In Polymerase Chain Reaction (PCR), the temperature is one of the most important parameters that…
A: Note: As per the guidelines, the first question has been solved here. Please post the other…
Q: 2. Human activity can be very disruptive to an ecosystem. Part of the forest shown in the picture…
A:
Q: Which of the following is FALSE about fruit? A. Mature ovary B. Protect seeds and aid in dispersal…
A: Introduction : Angiosperms are flowering plants that produce fruits with seeds inside of them. They…
Q: BHI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT M13-20 primer binding site Bsp 1061 goi Primer design…
A: It is required to use oligonucleotide primers while conducting a PCR reaction. Designing primers…
Q: Which of the following processes determines the arrangement of organs and tissues in their…
A:
Q: Use the following information to answer the next question. The Life Cycle of a Fern 1 and 3 2 and 4…
A: *A fern is a vascular plants which reproduce through spores and it doesnt have seeds and flowers.…
Q: How would scientists describe the density of a population? O 47 giraffes living on the African…
A: Population density can be defined as the average number of individuals that belong to a population…
Q: The same restriction digestion experiment was repeated for EcoR1 on the same DNA molecule. However,…
A: It is given that the incubation period of the restriction digestion with EcoRI on the same DNA was…
Q: During a mountain biking accident, your 45 year old sister and her excitable 14 year old daughter…
A: Introduction:- A broken bone also called as a fracture, is when a break goes through part or all of…
Q: Order: 1 L of 0.9% NS with 40,000 units of heparin over 24 hours. Calculate the rate in mL/h.
A: Heparin is used to prevent or treat certain blood vessel, heart, and lung conditions. Heparin is…
Q: If the primers you purchased possessed the following information. Number of Guanine: 5 Number of…
A: Melting temperature of primer depends on AT and GC content and length of primer. There are two…
Q: In Caulobacter crescentus development, several proteins are directly involved in generating cell…
A: The formation of cellular asymmetry is a critical phase in the evolution of many species, from…
Q: QUESTION 13 Recall that the liver is responsible for making many of the proteins in plasma,…
A: Albumin: Liver synthesizes a wide variety of proteins and one among them is albumin. Albumin…
Q: 3. Explain how exercise affected: a) level of activity, b) rate of cell respiration, and c)…
A: The overall health is improved via exercise, which gives people more energy throughout the day. But…
Q: Differentiate Invitrogen pCR® II-TOPO® Vector from pBR322 Vector.
A: Molecular cloning : Production of genetically identical copies of a cell or its genetic material is…
Q: For a scientific theory to be valid, it must allow you to get the same results each time. obtain new…
A: A scientific theory is a statement that is universally accepted and explains universal facts. The…
Q: Use the following information to answer the next question. Life Cycle of a Pronghorn Antelope…
A: The pronghorn contains deer like body whose tan is reddish brown. *Reproduction is the process of…
Q: Below is an image of translation occurring in the direction indicated by the arrow. Use the image…
A: An arrow has been given that signifies in which direction, translation is happening. Translation…
Q: Consider the maternal effect gene that controls snail coiling where D= dextral, dominant,…
A:
Q: M13 is a filamentous phage that infects the bacterium Escherichia coli. Infection with M13 is not…
A: A vector is a living organism that transmits an infectious agent from an infected animal to another…
Q: Flavr savr Tomato Golden rice, Roundup ready soyabean In order to generate GM foods mentioned above,…
A: Genetically modified food are produced by the manipulation of genome of the plants or organism…
Q: 7.13 In rabbits, the dominant allele C is required for colored fur; the recessive allele c makes the…
A: Introduction :- The relationship between two genetic variants is referred to as dominant. Each gene…
Q: The light dependent reactions of photosynthesis serve to __________ while the light independent…
A: Photosynthesis is a metabolic process by which green plants (that possess chlorophyll, which is…
Q: 2. *REQUIRED 1 A somatic cell in an organism develops a DNA mutation. This mutation is a beneficial…
A: The genetic traits are those which are transferred from parents to their offspring. Heritable traits…
Q: Cloning of an eukaryotic gene can be carried out in bacterial cells. However, for the protein…
A: Eukaryotic genes are the regions of DNA that act as templates for the production of RNA by RNA…
Discuss the formation of free radicals and their impact on cell and tissue health.
Step by step
Solved in 3 steps
- In 2-page worth of words (around 500), discuss in depth the risks and hazards of CYCLAMATE in the body. What will be the reactions and the harmful products and their effects? Why is this a concern?Describe the biochemical composition of cells.“Antioxidants are key molecules in slowing down cellular aging”-What is the mechanism behind this? Explain at your own words.
- Anemia is characterized by low hemoglobin levels or a reduced number of red blood cells (both of which transport oxygen to cells). A common symptom of anemia is tiredness. Please do not copy answers from another website/source. a) Briefly explain what the consequences are of anemia on cellular energy production. b) Suggest at least one other cellular effect of anemia and a brief explanation of this effect.Describe the structure and functions of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and adenosine triphosphate (ATP).Describe how reactive oxygen species alter DNA structure and cause mutations.