Consider the problem of searching for genes in DNA sequences using Hor-spool’s algorithm. ADNA sequence is represented by a text on the alphabet {A, C, G, T}, and the gene or gene segment is the pattern.  a. Construct the shift table for the following gene segment of your chromo-some 10: TCCTATTCTT  b. Apply Horspool’s algorithm to locate the above pattern in the following DNA sequence: TTATAGATCTCGTATTCTTTTATAGATCTCCTATTCTT

Q: You are studying a large eukaryotic gene that is 439,515 base pairs long. You find the polypeptide…

A: As proteins are polymers of amino acids, the chemical composition of the amino acid side chains and…

Q: a. What are the purposes of sequence alignment?

A: Sequence alignment is a method by which one can arrange sequences of DNA, RNA and protein so as to…

Q: A B C D A The following distance matrix: B C D 0.1 0.4 0.3 0.8 0.6 0.2 Using the UPGMA algorithm,…

A: The UPGMA (unweighted pair group method with arithmetic mean) method can be applied to construct a…

Q: With a few exceptions, interspersed repetitive DNA in the human genome has no known biological…

A: Human genome: The term human genome refers to the complete set of genetic instructions or DNA that…

Q: MATCH each of the following terms to a structure from the list below. There is only one correct…

A: Hope you understand...... Please do rate..... Thankyou :)  Have a good day ..

Q: E. How many nucleotides would be required to generate a polypeptide that is 15 amino acids long?…

A: The genetic code is a sequence of three-letter combinations of nucleotides called codons, each…

Q: What is the purpose of the ethidum bromide that you add to the gel? Why do you need to be careful…

A: Gel electrophoresis Gel electrophoresis, it is a technique by which one can separate and analyse the…

Q: Based from Fig. 1B, which of the following lanes contain a good quality genomic DNA? Bad quality…

A: Agarose Gel electrphoresis is done to segregate the DNA bands according to its size. The size can be…

Q: solve a given problem

A: introduction In bioinformatics, k-mers are substrings of length k contained within a biological…

Q: Propose a method for isolating a DNA fragment that is adjacent in the genome to a previously…

A: Deoxyribonucleic acid is a particle made out of two polynucleotide chains that loop around one…

Q: The human genome (3.4Gb) would be 2.3 metres long if stretched linearly. In not more than 200 words,…

A: The size of a genome varies depending on the complexity of the genomes of different species.

Q: Researchers have now narrowed down the region they willikely want to sequence. This region is…

A: Paget disease of bone is a localised, monostotic or polyostotic, progressive metabolic bone…

Q: Which one of the following options would be a good way to identify the location of the poly A tail…

A: Pre mRNA undergoes several post-transcriptional modifications. One of these modifications is…

Q: tail the process of Sanger sequencing. Include a diagram

A: Sequencing of genetic material involves visualizing the number and arrangement of base pairs. It is…

Q: The genomic DNA of an organism has a base composition of 60% C-G base pairs and 40% A-T base pairs.…

A: DNA stands for deoxyribonucleic acid. It is a genetic material. It is present in the nucleus and…

Q: A diploid organism with a 45,000-kb haploid genome contains 21% G residues. Calculate the number of…

A: According to Chargaff's rules, DNA from each cell of any organism should contain a 1:1 ratio (base…

Q: A typical eukaryotic chromosome found in humans has about 100 million bp of DNA. As noted in Chapter…

A: Chromosomes are the thread-like structures present inside the nucleus of the plant cell and animal…

Q: People who carry a theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA…

A: The SNP is single-nucleotide polymorphism is a variation of DNA sequence that occurs when single…

Q: Calculate the number of clones required to obtain with a probability of 0.99 a specifi c 5-kb…

A: A random collection of DNA fragments , typically representing the entire genome of an organism  that…

Q: The E. coli genome contains 1009 Chi sequences. Do these sequences occur at random, and, if not, how…

A: Recombination is the process of genetic reshuffling where the genetic material is shared within or…

Q: See the attachment and answer the following parts of the question: A) If the binturong genome is…

A: Binturong is a eukaryote in which there is highly repetitive DNA sequence is present. The copies of…

Q: Suppose that a nearly perfect 20-base-pair inverted repeat is observed in a DNA sequence. Provide…

A: The copies of the DNA sequences that are organized in opposing orientation are called “inverted…

Q: --TGT(G/C)CAG------3'

A: SNV means single nucleotide variants on individual RNA molecules To identify genomic differences we…

Q: Align two sequences: horizontal - GGAATGG, vertical – ATG, m = 1, mm = 0, g = -1. Use the table…

A: Global Alignment: It is a bioinformatics algorithm used to align protein or nucleotide sequences. A…

Q: The xyz gene product, encoded by a new viral strain, has coresponding human homologs. Blast analyses…

A: Scoring matrix  Scoring matrix measures the similarity between two characters in sequence alignment.…

Q: Why does evenly distributed peak in DNA chromatogram is an indication of a good sequence?

A: Evenly spaced peaks indeed indicate a good DNA sequence. Generally, four colours of peaks are…

Q: Describe the outcome of a chain-terminator sequencing procedure in which (a) too little ddNTP is…

A: Sanger DNA sequencing is also known as the sequencing process of chain-termination. In addition to…

Q: are using the restriction enzyme HAEIII to digest different samples of the taster gene isolated from…

A: In gel electrophoresis DNA to be tested is broken down by various restriction endonucleases into…

Q: In hybridizing microarrays, we use a solution that contains {3X SSC, 0.5% SDS, 5ug/ml salmon sperm…

A: The ratio of mass of solute present in a solution relative to the volume of the solution represents…

Q: Part 2. Dynamic Programming Assignment, Needleman-Wunsch Algorithm, Affine Gap Cost Align two…

A: Needleman-Wunsch Algorithm is used for global alignment of nucleotide sequences. Here; 'm' is the…

Q: Compute the percent identity of the following pairwise sequence alignment: -TGAGACTTAGAGT |..|... |…

A: In bioinformatics, sequence alignment is a process by which two or more sequences are arranged to…

Q: Eukaryotic genomes are replete with repetitive sequences that make genome assembly from…

A: Tandem repeats of the dinucleotide sequence are the repetitive sequences that are found at many…

Q: You are studying a genome that has 42% G:C content and the remaining 58% of the genome is As and Ts.…

A: Restriction enzymes  The enzyme that is use to cut the DNA at specific site.

Q: Using the Dynamic Programming algorithm for pairwise local alignment we covered in class, construct…

A:

Q: Describe the difference between Sanger based sequencing and Next Generation Sequencing (NGS). Why is…

A: Step 1 Sequencing is the establishment of the primary structure of an unbranched polymer. Sequencing…

Q: Assuming that the mean size of the human sau3AI partially digested fragments clones is 3kb,…

A: Human sau3AI is a tool used to help predict and diagnose disease. It is a blood test that looks for…

Q: The human genome is approximately 3 billion basepairs in size.a. Using standard 8.5″ × 11″ paper…

A: "Since you have posted a question with multiple questions, we will solve the first question for you.…

Q: Discuss why it is useful to search a database to identify sequencesthat are homologous to a newly…

A: The most basic operations in bioinformatics involves searching for similarities, or homologies,…

Q: Compute the [A + C]/[T or U] +G] ratios of the DNA and RNA models. Do you expect the same values for…

A: Adenine (A) pairs with Thymine (T): Adenine (A) always forms hydrogen bonds with thymine (T) in…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.