If the following piece of the partially double stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and add DNA polymerase, dTTP,dGTP and dCTP, what will be the sequence of the nucleotides that will be added? A. 5' ATCGCCGTAGGC 3' B 5' GGCATCCG 3' C. 5' CCGT 3' D 5'CCGTAGGC 3' E 5'GGC 3'

During DNA replication, the function of RNA primers is to  Group of answer choices serve as a binding site for DNA ligase separate the two strands of the double helix to open replication "bubbles" serve as starting points for DNA strand elongation by DNA polymerase in the 3' - 5' direction prevent new-separated strands of DNA from rejoining serve as starting points for DNA strand elongation in the 5' - 3' direction by DNA polymerase

Match Column A with Column B. unwinds the two DNA strands at the replication A. DNA Gyrase fork B. Primase stabilize ssDNA as it forms so it will not anneal C. Helicase to reform the double helix releases the tension (positive supercoils) ahead D. Single-strand DNA binding proteins (SSB) of the replication fork caused by the unwinding of the DNA helix E. DNA polymerase synthesizes DNA v proofread the newly synthesized DNA v remove RNA in lagging strand initiates DNA synthesis by placing first RNA on the DNA template v removing errors in the newly synthesized DNA filing in the gaps in Lagging strand > >

Which of (a)-(d) is complementary to the DNA segment 5'-ATGAGCCAT-3'? * 5-ТАСТССGTА-3' 5-ТАСТСGGTА-3' 5'-TCATCGGTA-3' 5'-TACTGCGTA-3'

The single strand of DNA below forms a stem-loop structure structure with a loop that is 6 nucleotides long. 5’   - T A T C G C T A __ __ __ __ __ __ __ __ - 3’ What are the rest of the nucleotides? Group of answer choices a. 5’ – ATAGCATC – 3’ b. 5’ – CTACGATA – 3’ c. 5’ – AATCGTAG – 3’ d. 5’ – GATGCTAA – 3’

Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’  1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.

E.coli is replicating its chromosome. If the template DNA sequence is: 3' AAA CGC GAT 5', what would be the base sequence of the complementary new DNA strand? O 5'TTT GCG CTA 3' 5' UUU GCG AAU 3' O 3' UUU GCG AAU 5' O 3' TTT GCG AAT 5'

On paper, replicate the following segment of DNA:            5’ A T C G G C T A C G T T C A C 3’            3’ T A G C C G A T G C A A G T G 5’a. Show the direction of replication of the new strands and explainwhat causes lagging and leading strands to show different patternsof replication.b. Explain how this is semiconservative replication. Are the newstrands identical to the original segment of DNA?

Which of the following sequences is the best description of the complementary DNA sequence to the following sequence:   5'-CGATTAGC-3' Group of answer choices 5'-GCTAATCG-3' 5'-GCUAAUCG-3' 3'-CGATTAGC-5' 3'-GCUAAUCG-5' 3'-GCTAATCG-5'

The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during polymerase chain reaction (PCR) replication. Which of the following options best represents the primer?5’ – CGCGTATCGGGCTGTCGCGTCTTGCAGCTCG – 3’   a. 5’ – CGAUACGC – 3’   b. 5’ – CGATACGC – 3’   c. 5’ – CGAGCUGC – 3’   d. 5’ – CGAGCTGC – 3’   e. None of the above