Choose the statement below that is true about the characteristics of the bacterial fertility factor factor. O The fertility factor carries genes responsible for uptake of naked DNA, and has several IS elements to assist plasmid integration into host cell's chromosome. The fertility factor carries genes responsible for formation of bacteriophages, and has several IS elements to assist plasmid transfer through the sex pilus. O The fertlity factor carries genes responsible for formation of sex pili, and has several IS elements to assist plasmid integration into host cell's chromosome. The fertility factor carries genes responsible for formation of sex pili, and has several IS elements to assist plasmid transfer through the sex pilus.

Q: Embryonated eggs are widely used for viral cultivation. Explain

A: Prior to the development of cell culture, most of viruses were propagated using embryonated eggs.…

Q: All of the following lead to horizontal gene transfer EXCEPT plasmids transfer of genetic material…

A: Gene transfer refers to the movement of genetic information between organisms. Gene transfer can be…

Q: What removes the Lacl repressor protein so the gene of interest in a plasmid can be induced to be…

A: The lac operon refers to the region present in the DNA of E.coli. It comprises three genes that…

Q: What is true regarding the following cross between bacterial strains: F’ x F-?   As the donor, F'…

A: Conjugation is a mechanism of horizontal gene transfer in which bacteria transfer genetic material…

Q: Define restriction point,

A: The cell cycle is the initial process that cells follow to prepare themselves for cell division.…

Q: Which of the following is a known characteristic that can lead to genetic changes in some viruses?…

A: viruses need host cell machinery to replicate themselves.

Q: Which of the following is not a reason why China instituted a one-child policy? a) Increased air…

A: The one-child policy in China was initiated in 1979 which was launched by the Chinese State Council…

Q: How would a technique of using the luciferase plasmid be to verify that the estrogen receptor was…

A: Tamoxifen is defined as the hormone therapy for "breast cancer " in both men and women. Sometimes,…

Q: What is the function of the capsule?

A: Bacterial cell has  different components which are divided into:  structures external to the cell…

Q: Describe the events (in words) occurring during conjugation in bacterial cells (using F plasmid…

A: Bacterial conjugation is the transfer of genetic material between bacterial cells by direct…

Q: pXO1 and pXO2 are large plasmids – large pieces of DNA that are not the chromosome that can…

A: Plasmids are the extra chromosomal material which are present independently of  the main…

Q: What is required to package the T4 genome into its phage head?

A: Introduction  T4 is a type bacteriophage which infects the E coli bacteria (Escherichia coli). It is…

Q: Describe the role that integrase plays during the insertion of λDNA into the host chromosome.

A: Integrase is a viral enzyme that catalyzes the integration of virally derived DNA into host cell…

Q: Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for…

A: Explanation: A plasmid is a circular piece of DNA that will be utilized in the process of inserting…

Q: The dUTPase enzyme is used by the African swine fever virus to repair its own DNA, as the cells the…

A: The African swine fever (ASF) virus is DNA virus, having double stranded DNA as it's genetic…

Q: How can one confirm/investigate the type of inhibition exerted by azt on the hiv reverse…

A: 3'-azido-3'-deoxythymidine (AZT) is a Thymine analogue. It inhibits HIV reverse transcriptase by…

Q: For Figure 15-7, draw out a series of steps that could explain the origin of this large plasmid…

A: We need to provide the process leading to the origin of a large plasmid containing various…

Q: A plasmid provides its host with kanamycin resistance. What will happen to the plasmid if you…

A: Plasmids are defined as extrachromosomal circular genetic elements that are capable of…

Q: Which plasmid contains the therapeutic gene? 1 - the plasmids with SERCA2a 2- the viral plasmid 3-…

A: The adenoviruses are generally used for making recombinant animal cells.

Q: explain  Resistance plasmids

A: Plasmid is a genetic structure in a cell that can replicate independently of the chromosomes,…

Q: E. coli Hfr cells   Choose an answer below: can transfer genes to F- cells. can form sex pili (F…

A: E.coli Hfr cells are the high frequency cells and during the conjugation process between the Hfr…

Q: In conjugation involving the F plasmid of Escherichia coli, how isthe host chromosome mobilized?

A: Conjugation is a method of horizontal gene transfer common in bacterium in which a donor bacterium…

Q: Despite being asexual, bacteria can develop genetic variability during the process of conjugation.…

A: Conjugation is a process involving the exchange of genetic material between bacteria via direct…

Q: Differentiate between TWO of the following pairs: Genetic and a restriction map Southern and…

A: The mapping of DNA refers to the identification of the location of particular genes. Genetic map and…

Q: Describe how the one step growth experiment demonstrates the events that take place during the lytic…

A: One step growth experiment: In this experiment only a single or one cycle of virus growth is…

Q: At which sites in the chromosome can the F plasmid integrate?

A: The F (fertility) plasmid is also called as the f factor.

Q: Explain briefly about The Case of Genetically Modified Tomato Paste

A: A plants  whose the DNA has been modified using genetic engineering method are known as genetically…

Q: Is the genus alcaligenes gelatin negative or postive?

A: Prokaryotes are single-celled microscopic organisms belongs to the domain bacteria. A prokaryotic…

Q: Ti Vector Plasmid Hfr HIV Bacteriophage

A: Introduction: In molecular biology, a vector is a DNA molecule (usually plasmid or virus) that is…

Q: How does lambda excise and replicate during the lytic cycle? Explain the factors that determine…

A: Lambda may be a mild bacteriophage that can coordinate its genome into the genome of the host…

Q: The figure below shows the life cycle of the fungus Neurospora. The adult stage of the Neurospora is…

A: The answer is given below.

Q: A plasmid that encodes for a relaxase complex but does not contain the genes necessary to make a…

A:

Q: plasmid DNA replication

A: C option is correct. In Hfr cell F factor is integrated into the chromosomal bacteria. During…

Q: Describe how you would genetically design a superbugresistant to b-lactams, methicillin,…

A: Superbugs are strains of viruses, bacteria, fungi, and parasites that are resistant to most the…

Q: Consider a hypothetical phage whose DNA replicates exclusively by rolling circle replication. A…

A: As per semi conservative model of DNA replication, the newly synthesized daughter DNA molecule will…

Q: Which of the following statements is true of plasmids? A Agrobacteria use plasmids to induce tumors…

A: Options - 1, 2, 4, 5, 6  are true

Q: Ester Lederberg's discovery of the lambda phage and F-plasmid were significant because: (select all…

A: Esther Lederberg, a microbiologist and a scientist who pioneered the field of bacterial genetics,…

Q: If a vector containing the desired gene X is inserted into a microorganism, for instance,…

A: The purpose of this experiment is to insert a vector containing the gene X into the microorganism…

Q: In Figure 5-15, how are each of the following genotypesproduced?a. F+ a− c. F− a+b. F− a− d. F+ a+

A: Recombination is a technique by which pieces of DNA are broken and recombined to produce new…

Q: draw structure of plasmid

A: The plasmid is the extrachromosomal deoxyribonucleic acid (DNA) that is present with the bacterial…

Q: Explain the process of the DNA recombination for the production of Golden Rice from conventional…

A: Golden Rice is a rice type (Oryza sativa) that has been genetically modified to generate…

Bacterial Genomics

The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.

Transformation Experiment in Bacteria

In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.

Plasmids and Vectors

The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.