Q: 1. Make a diagram of DNA replication. 2. Discuss DNA to RNA transcription (ATLEAST 5 SENTENCES).
A: DNA replication is the process by which a double-stranded DNA molecule is copied to produce two…
Q: List seven enzymes and proteins needed in a DNA Replication. Briefly state their functions
A: DNA is made up of various nucleotides that store genetic information in it. DNA is packed into a…
Q: Think about DNA replication versus RNA transcription - which of the following statements is true…
A: DNA replication is semi conservative, that is, not entire product is similar to template, but it is…
Q: What process in protein synthesis that is NOT affected by a silent mutation? Select one: a. Synapsis…
A: Each protein molecule has hundreds, if not thousands, of amino acids that are linked together in a…
Q: 2. Fill in the labels on this diagram of a DNA molecule: Adenine Thymine .H2N OH NH H2N NH N' NH;…
A: DNA is deoxyribonucleic acid. It is a molecule of herdity. it is made up of nucleotides. A…
Q: 1. What are the differences between DNA and RNA? 2. Which process involves copying of DNA…
A: Note :- Since you have asked multiple questions im only answering the ist 3 as per bartleby…
Q: 1.Make a flow diagram to describe each of the prokaryotic DNA repair mechanism 2. Give 2 examples of…
A: DNA repair is a constant process in the cells where the damage is repaired. The cell contains a…
Q: Distinguish DNA and RNA according to their structure and functions.
A: DNA & RNA are the nucleic acid found in living organism. DNA: Deoxyribonucleic acid RNA:…
Q: 1. Label the diagram below with the following terms: O DNA Ribosome MRNA Transcription tRNA…
A: Transcription and translation are the components of gene expression. These two processes are known…
Q: 1. Describe at least four ways in which transcription is different from DNA replication.
A: As per our company's guidelines we are supposed to answer a single question at a time only. Please…
Q: 3. Draw the DNA replication process. (label the enzymes and other requirements)
A: Answer : DNA replication process is the three step process which takes place one after another. The…
Q: 8) Which of these describes the function of RNA polymerase? A. Amplifies the “message" by making…
A: Need to find which of the following is correct regarding RNA polymerase function.
Q: 2. Identify the following structures when given images such as the ones below: ● process of…
A: Introduction The cell is the basic structural and functional unit of life present in all living…
Q: 6. When can a mutation on the DNA cause production of a longer translation product? Give a specific…
A: * Types of gene variations Missence Nonsense Frameshift mutation Insertions Deletions Inversions…
Q: 1. What is called the functional unit of a DNA molecule that may code for RNA or protein? A. arnino…
A: DNA or deoxyribonucleic acid is the molecule that is made up of polynucleotide chains coiled around…
Q: During protein synthesis, which of the following are involved in the steps that take place in the…
A: Protein synthesis takes place via a process called translation . Before translation mRna have to be…
Q: 3. Label the illustration below using the following terms: DNA, MRNA, codon, transcrip translation,…
A: All the living organisms contain genetic material. The genetic material is responsible for passing…
Q: Explain how is DNA replicated and repaired?
A: Hi! As you have posted multiple questions and have not mentioned which is to be answered, we are…
Q: 36/ In the figure representing DNA replication represents the leading strand? AA C.C DD None of the…
A: DNA replication means making a replica or copy of the DNA strands. DNA is a double-stranded…
Q: 2. The organization of DNA requires that replication be performed by a large “machine of proteins."…
A: Deoxyribonucleic acid (DNA) stores the cell’s genetic information and is present in the nucleus of…
Q: 1. Using the central dogma of molecular biology, explain the terms replication, transcription and…
A: Since you have asked multiple questions, we will answer only the first question for you. If you want…
Q: 6) The diagram shows a strand of DNA matched to a strand of messenger RNA. MRNA is being made from…
A: Francis crick proposed central dogma which gives the flow of genetic information from DNA to RNA to…
Q: 4. During DNA replication, half of the strand is conserved in the new molecules created. This is…
A: 4. During DNA replication, half of the strand of conserved in the new molecules created. This is…
Q: 7. An original strand of DNA has the following sequence of nucleotides: NNNNONNNNNNINN CC AT CTGGA…
A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polymeric molecules essential in various…
Q: Identify 5 common characteristics of transcription and replication
A: Transcription is a process in which the information in the template strand of a DNA is copied into a…
Q: What is the function of DNA? 2. What two membranes protect the fragile DNA molecules from damage?
A: According to this Watson and Crick model, both the strands of DNA were connected by hydrogen bonds…
Q: Which process in protein synthesis is most affected by a silent mutation? Select one: a. Replication…
A: Silent mutation are essentially base replacements that outcome in no difference in the amino acid or…
Q: 4, Describe the process of DNA replication. In your description, include the terms polymerase,…
A: DNA is a double-stranded molecule that is composed of deoxyribose sugar, a phosphate, and a…
Q: What is the role of Ligase in DNA replication?
A: DNA is the genetic material present in the nucleus.
Q: what is the diagram depictin A) transcription and translation return B. DNA replication C -DNA…
A: Gene is a hereditary units that are present on the Chromosome. It contain genetic instructions . DNA…
Q: 9) Which statement is inaccurate (wrong) about mRNA? A) it is double stranded and has thymine B) it…
A: The explanation for the wrong statement is given below.
Q: 1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA…
A: The process of the formation of the mRNA from the DNA is called as transcription. The process of the…
Q: Discuss the stages or process of DNA and Cell replication. 2. What is DNA repair and discuss
A: DNA is a double stranded molecule which are linked together by hydrogen bonds. DNA replication means…
Q: When DNA replicates, how is it able to “unwind” its double helix?
A: DNA is able to unwind it's double helix with the help of enzyme DNA Helicase.
Q: 9. What is the purpose of the following? a) spliceosomes b) RNA polymerase c) Protein release…
A: The central dogma of molecular biology involves the processes of transcription and translation that…
Q: 3. The principle theme in biology is DNA transcribes to RNA and RNA translates to proteins. Place…
A: Introduction: The process of copying the genetic information from one strand of the DNA into RNA is…
Q: How many codons are there in the mRNA?
A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…
Q: 4. How is replication different from transcription in terms of product? 5. What do you call each…
A: DNA is the deoxyribonucleic acid which contains the genetic coding of an individual.
Q: How are nucleotides formed?
A: Hi! As you have posted multiple questions and have not mentioned which is to be answered, we are…
Q: 1. Decoding mRNA into amino acids is called translation.
A: above given statements are about transcription, translation process and how amino acids makes a…
Q: What is the main difference in the behavior of DNA and RNA polymerases?
A: Both DNA polymerases and RNA polymerases are enzymes.DNA polymerases are mainly involved during the…
Q: 7. A mad scientist has all the molecules necessary for protein synthesis in a test tube. Included in…
A: The genetic material that makes up DNA is referred to as the "building block of life." Many…
Q: 12. A diagram of DNA replication is shown below. Redraw the diagram into copybook and fill in the…
A: DNA replication: a. During DNA replication, an exact copy of DNA is made from the template strand.…
Q: Discuss the difference between intron and Exon
A: Exons are named as nucleic acid coding successions & they are available in mRNA. Introns are…
Q: 1. What will happen if there is a mistake in DNA replication? 2. What will happen if there is a…
A: In molecular biology DNA replication is the process in which DNA makes a copy of itself during the…
Q: 1. When can a mutation on the DNA cause shortening of the translation product? Give a specific…
A: A single nucleotide or nucleic acid can be affected by a point mutation. When one base is replaced…
Q: What is DNA replication? 2. What are the principles of DNA replication?
A: DNA replication DNA , deoxyribonucleic acid , is made up of three components , a deoxyribose sugar ,…
Q: 8. What is the function of polymerase? It adds nucleotides. It unwinds the original DNA strand. It…
A:
Q: 2. Manufacturing biological molecules in the laboratory requires the use of relatively pure…
A: In a cellular compartment, the synthesis of biological molecules takes place in a series of steps…
Step by step
Solved in 2 steps with 1 images
- 1. How are nucleotides formed? In details summarize the process of DNA replication. In details summarize the process of Translation and post translation process. In details summarize the process of transcription. Explain how do you sequence the DNA1. What will happen if there is a mistake in DNA replication? 2. What will happen if there is a mistake in translation or protein synthesis?1. Discuss the stages or process of DNA and Cell replication. 2. What is DNA repair and discuss its cycle?
- 7. An original strand of DNA has the following sequence of nucleotides: NNNNONNNNNNINN CC AT CTGGA ACACTACTTAA AATAACA nnnnnnOnNnNNnnnnnn UUUDOUUUUUUUUUUUUUUUUUUUU Fill in the corresponding nucleotides for the RNA strand.1. Make a diagram of DNA replication. 2. Discuss DNA to RNA transcription (ATLEAST 5 SENTENCES).3. Draw the DNA replication process. (label the enzymes and other requirements)
- 1. What is the function of DNA? 2. What two membranes protect the fragile DNA molecules from damage?3. List seven enzymes and proteins needed in a DNA Replication. Briefly state their functions.21.An RNA or DNA molecule is a polymer made of subunits called 22.Which of the following is NOT needed for protein synthesis a, tRNA b, spindle fibers c, enzymes d, ribosomes 23. What does DNA do inside the cell? it destroys incorrect nucleotides in the nucleus it maintains the integrity of the nuclear membrane It prevents the excess buildup of nucleotide bases it directs the synthesis of proteins 24. What is a genome? Group of answer choices The complete collection of an organisms genetic information The combination of proteins and DNA found in the sex cells All the genes found in a population The number of chromosomes found in each cell
- 1. Define transcription and translation. Which process occurs first to make protein from DNA? 2. In what direction does a polymerase move when synthesizing a strand of mRNA?20. Three structures are represented in the diagram below. Cell DNA Protein What is the relationship between these three structures? The cell is composed only of DNA and protein. DNA controls the production of protein in the cell. ODNA is made up of proteins that are synthesized in the cell. O Protein is composed of DNA that is stored in the cell.1. Distinguish DNA and RNA according to their structure and functions.