What is the role of Ligase in DNA replication?

1. Name all the proteins that are in the DNA replication fork in E. Coli, and describe the functions of these proteins. Explain how two DNA strands are replicated at the same time by one replication fork.

23. Human genetic material is represented in the diagram below. The region labeled A is made up of a section of O glucose that may be copied to make DNA DNA that may direct protein synthesis a protein that becomes an enzyme a carbohydrate made from amino acids

10. Replication is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d) polypeptideà amino acids

7. Which of the following phosphates in a single-stranded DNA molecule is covalently attached to a carbon (in the deoxyribose sugar), but that phosphate is not part of a phosphodiester bond? the phosphate attached to the 5’-carbon on the first deoxyribose sugar of this single DNA strand the phosphate attached to the 5’-carbon on the last deoxyribose sugar of this single DNA strand the phosphate attached to the 3’-carbon on the first deoxyribose sugar of this single DNA strand the phosphate attached to the 3’-carbon on the last deoxyribose sugar of this single DNA strand all of the above

5. On this replication fork, draw in all of the enzymes and proteins required for DNA replication (DNA Polymerase, helicase, topoisomerase, ligase, primase, and exonuclease). Also draw in and label the primer and new DNA. Indicate which is the leading and lagging strand Label all 5' and 3' ends.

16. The process of attaching biological functions to DNA sequences is called?

2.  List the DNA strand sequence complementary to the template strand. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .

(3) If a DNA sequence is 5' TCC GGT CAT 3' what are the RNA and protein sequences that can be made from the strand?

1. What are chromosomes and where are they located? 2. How many chromosome do humans have? How are chromosomes inherited? 3. What are the components of a nucleotide? Name the four types of nucleotides. 4. What type of bonds holds the two DNA strands together? 5. What is complementary base pairing? 6. How does the DNA between individuals differ? 7. Define DNA replication 8. What is the function of the enzyme helicase in DNA replication? (unwinds and unzips DNA) 9. What is the function of the enzyme DNA polymerase in DNA replication? 10. DNA replication is semiconservative. Explain what this means. 11. Which method do scientist utilize to make extra copies (amplification) of DNA? 12. Describe the PCR technique. Why do scientist add primers, DNA polymerase and nucleotides during PCR method? Explain the purpose of each.