QUESTION 5 Observe this replication fork. The lagging strand is the O Top O Bottom Click Save and Subrnit to save and submit. Click Save All Answers to save all answers. e to search
Q: In the following diagram of DNA replication fork, A is_. A e 5' 3'OH 3 OH
A: DNA ( deoxyribonucleic acid) ismade up of repeating units of the nucleotides, hence these are known…
Q: DNA polymerases have a shape resembling a right hand with three functional domains. What are the…
A: The enzyme DNA polymerase is in charge of DNA replication. This enzyme's purpose is to split a…
Q: Which of the following is NOT true of the telomerase enzyme? Question 4 options: A) Its adds a…
A: Cell is a structural and functional unit of living organisms. Several cells joined together to form…
Q: At a replication fork, which strand is synthesized discontinuously? O lagging O leading
A: Replication is an important process taking place in all living organisms that ensure the maintenance…
Q: Question 2 Describe how DNA polymerases achieve processivity in prokaryotes.
A: Introduction :- Prokaryotes are creatures without a nucleus or other organelles in their cells.…
Q: explain why you chose that answer. Your explanation should discuss the replication of DNA in…
A: DNA replication is the process by which a double-stranded DNA particle is duplicated to deliver two…
Q: Question 1. Why is DNA replication called semiconservative?
A: DNA replication is the process in which dsDNA is copied to produce two identical DNA molecules.
Q: Question 8 of 10 Question 8. The backbone of a DNA molecule is sugars alone dn а. made of b. made up…
A: The DNA or deoxyribo nucleic acid is the genetic material that is composed of nucleotides. It is…
Q: In light of your knowledge of DNA replication, discuss the following statement: "Only the DNA is…
A: Dna replicates semiconservatively is proven by matthew meselson and franklin stahl by performing an…
Q: Which event in prokaryotes is most like the segregation of sister chromatids in eukaryotic mitosis?…
A: Cell division is a natural process in which a parent cell divides into two daughter cells. Cell…
Q: Part C: The Big Picture – In this part, you will use answer questions. 1. When you were creating the…
A: DNA replication is a process where DNA makes a copy of itself to produce two identical DNA…
Q: Which of the following is true of DNA repair?
A: DNA repair is the process by which a cell identifies any damage in the DNA and rectifies it. It is…
Q: Question 1 What gives the DNA molecule a negative charge? (A deoxyribose (B) ribose c phosphate…
A: DNA or deoxyribonucleic acid is genetic material in living organisms that are responsible for…
Q: Question 2 Match the following terms having to do with DNA Replication. helicase DNA ligase DNA…
A: DNA replication It is defined as the process of copying double-stranded DNA molecules to produce two…
Q: True or False: Polymerases open the DNA and create the replication bubble while helicases run…
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains which wrap around one…
Q: QUESTION 2 During which stage of the replication cycle do viruses get their envelopes? Attachment…
A: ATTACHMENT.- Viral protien on the caspid or phospholipid envolop interat with specific receptors on…
Q: In DNA cloning, restriction enzymes are used to cut a DNA at specific sites b protein at specific…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Below is a double strand DNA sequence contain a gene and it will go under transcription, suppose…
A: Introduction Translation is the process through which a cell uses the genetic information relayed in…
Q: What enzyme initiates DNA replication? a. ligase b. helicase O c. primase d. gyrase
A: Which enzymes initiates the DNA replication? DNA replication is bidirectional and originates at a…
Q: Question 3 In the polymerase chain reaction A conditions must be carefully controlled to prevent…
A: PCR is a technique which amplifies a DNA template or strand to produce thousands number of copies of…
Q: The replication of chromosomes by eukaryotes occurs in a relatively short period of time because ?…
A: The DNA replication is the production of new DNA from the old DNA by the semiconservative manner. In…
Q: Question 4. Why is a single-stranded, circular DNA an ineffective template for DNA polymerase?
A: Introduction Single-stranded DNA is a DNA molecule that has only one nucleotide strand while…
Q: In the following image, A and B are and chromosomes C D E F A Replication
A: Chromosomes are thread-like structures found within the nucleus of both animal and plant cells.…
Q: DNA pol 3's inability to begin the replication process is solved by which enzyme? helicase primase…
A: DNA is genetic material in most of organisms . It act as template for synthesis of its own . This…
Q: There are 2 parts to this question: The following DNA strand (below) is about to undergo DNA…
A: The cellular functions are regulated/controlled by the DNA present within the nucleus of the cell.…
Q: During DNA replication, the two new daughter DNA strands have to be made at the same time in the…
A:
Q: Question 3. How is the primer different in eukaryotic DNA replication than prokaryotic DNA…
A: Primer is a small sized single stranded monomeric nucleotide needed by all living creatures to start…
Q: (a) Eukaryotic DNA replication is more complex than prokaryotic replication. Give one reason why…
A: a. Eukaryotic DNA replication is more complicated than prokaryotic replication because of the…
Q: Just prior to DNA replication the cytosine in the sequence GTTCATTG is deaminated and it is not…
A: The deamination means removal of the amino group (-NH2) from a particular molecule. In the cell…
Q: A technology called PCR is used for replicating large quantities of DNA in forensic science (Chapter…
A: Introduction PCR is the revolutionized technique invented by Karry Mullis in 1983, for which he got…
Q: responte Question 29 Multipie Answer Question: Erwin Chargaff's rules state that in a typical…
A: Chargaff has stated the rule for the base pairing of DNA in a double-stranded structure. The first…
Q: For the following DNA sequence along a chromosome answer the following questions: The enzymes…
A: The first is referred to as the leading thread. This is the parent strand of DNA, which travels in…
Q: Question 2 Cutting DNA into various size fragments is part of... Genetic fingerprinting Genetic…
A: Answer
Q: QUESTION 2 What is the most common mechanism among eukaryotes for increasing the number of…
A: An error in deoxyribonucleic acid (DNA) replication results in the formation of short genetic…
Q: Question 3 Based on the animation. DNA is a right handed double helix. O True O False
A: Deoxyribonucleic acid is a molecule consist of nucleotide in which contain sugar, phosphate group…
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 3.…
A: DNA is composed of two polynucleotide strands which wrapped around each other like helix- like…
Q: Question 2. What does DNA polymerase need in order to make contact with a replication origin?
A: DNA polymerase an enzyme that can synthesize a new DNA strand on a DNA template is called a DNA…
Q: Below is a diagram of DNA replication as currently believed to occur in E. coli. Arrows start from…
A: DNA replication is the process of producing two identical replicas of DNA from one original DNA…
Q: Question 1 Review DNA sequencing, which method uses a dideoxy chain termination? O Next-generation…
A: Dideoxynucleotides are DNA polymerase chain-elongating inhibitors utilised in the Sanger technique…
Q: Question 39 Where would you find the chromosome of a bacterium? bacteria do not have chromosomes…
A: Introduction Prokaryotic cell is the primitive cell which lacks well-defined nucleus with…
Q: What role do the following enzymes play in DNA replication? DNA polymerase Helicase…
A: DNA replication is the DNA dependent DNA synthesis process. In this process a set of enzyme…
Q: DNA polymerase
A: For DNA to under replication it requires different proteins and enzymes. They are, DNA polymerases,…
Q: There are 6 parts to this question: This is a follow up to the prior question regarding the…
A: C. DNA Helicase- The enzyme responsible for separating the two strands of DNA in a helix so that…
Q: Question 1 Origin 5' 3' 3 5' Unwinding Unwinding Origin Question 1: The following diagram (below)…
A: Replication is a process by which the DNA is duplicated to form two identical copies of DNA using…
Q: QUESTION 7 If a person avoided all mutagens, they would not have any mutations O True O False
A: Mutagen Mutagen is a physical or chemical agent that causes mutation i.e. changes the genetic…
Q: D) UNI OR BIDIRECTIONAL Replication forks move in one or opposite directions (a) Unidirectional…
A: This picture is showing the directionality of the replication of the DNA. The DNA replication…
Q: At which point during DNA replication is genetic lost from the telomeres? Enzymatic action of…
A: Replication is the process of making two identical DNA molecules from a double-stranded DNA…
Q: QUESTION 5 Avery showed that the Transforming principle was destroyed by O DNA digesting enzymes O…
A: Transforming principle was given by Oswald Avery, Colin MacLeod and Maclyn MacCarty in 1944. They…
Q: Which of the following statements regarding ionizing radiation is FALSE? Question options:…
A: Electromagnetic waves are waves with both particle and wave nature. They are produced by vibrations…
Q: TRUE OR FALSE: a) DNA replication requires the participation of at least 8 nucleoside…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Step by step
Solved in 2 steps with 1 images
- QUESTION 6 Place the Polymerase Chain Reaction events listed below in the order in which they occur. Double-stranded DNA is produced DNA sample is heated Test tube with DNA sample is placed in machine Taq polymerase initiates DNA synthesis DNA denaturesQuestion 39 The graphic below shows Taq polymerase extending the primer upon a strand of DNA. What is a possible resulting sequence of the complementary strand after the reaction is finished assuming adequate amounts of all normal nucleotides and some ddGTP? 5' 5' O GATGC O TGCG O ATGC AGATGC с POLYMERASE 3" T G C '5' 3º inQUESTION 21 What model is currently accepted for DNA replication? O Conservative Model Semi-Dispersive Model O Semi-Conservative Model O Dispersive Model QUESTION 22 Which of the following enzymes replicates DNA? O DNA polymerase O Helicase O Ligase O RNA polymerase QUESTION 23 The lagging strand is svnthesized in:. Click Save and Submit to save and submit. Click Save All Answers to save all answers. Type here to search
- QUESTION 9 These are enzymes that untwist the double helix at the replication forks of replicating DNA. Helicases Stingle-strand binding proteins Topoisomerase TelomeraseQUESTION 6 These correct “overwinding” ahead of the replication forks by breaking, swiveling, and rejoining DNA strands. Helicases Single-strand binding proteins Topoisomerase TelomeraseQuestion 3. How is the primer different in eukaryotic DNA replication than prokaryotic DNA replication?
- Question 6 of 13 DNA A-5 GGG GCT AGC CCC 3 DNA B-3 ATA TAT ATA CCC S ONA C= STAC GTT ACG TCG 3 DNA D-3 ATC TTT GCATTA S The DNA strand whose complementary RNA contains a stop codon starting at the 5 end Select the correct response none of the above 2PQuestion 4 Okazaki fragments O are short DNA fragments are intermediates in DNA replication O begin with a short RNA primer all the above L. AMoving to another question will save this respo 0000Partial Question 6 Which of the following are true about replisome components at the replication fork? There are two DNA helicases at each replication fork: one for the leading strand and one for the lagging strand. There are two sliding processivity clamps at each replication fork: one for the leading strand and one for the lagging strand. Primase synthesizes new primers made of DNA every -500-5000 nt on the lagging strand. The clamp loader complex (y) loads new sliding processivity clamps (B) every ~500-5000 nt on the lagging strand. The two DNA polymerase cores travel together in the same direction even though the two template DNA strands run 5'→3' in the opposite direction (antiparallel).
- Question 1 Review DNA sequencing, which method uses a dideoxy chain termination? Next-generation sequencing (NGS) Sanger sequencing the third generation sequencingQUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.Question 8. You isolate the DNA from the bacterial cells and apply the Sanger dideoxy sequencing method. You then separate the products of the reactions by gel electrophoresis and obtain the following pattern. What is the sequence of the template and the DNA on the gel? ddATP ddTTP ddCTP ddGTP Template V [ Choose 3'-CTAGTCAAGG-5' 5'-CTAGTCAAGG-3' Sequence 3'-GATCAGTTCC-5' 5'-GATCAGTTCC-3' 5'-GGAACTGATC-3'