Based on the data shown where is the DNA binding domain? Explain which constructs helped you reach this conclusion? Which part of the protein is the Activation domain? Explain which constructs helped you reach your conclusion? The schematic (a)below is that of a reporter-gene construct - containing a lacz reporter gene (encodingB-galactosidase) and a TATA box ligated to UASGAL, a regulatory element that contains several bindingsites for transcription factor Gal4.(a) Reporter-gene construct(b) Expression Vector construct: Various plasmids containing coding sequences of wild-type or mutant(portions of coding sequence deleted) Gal4 were made. (Plasmid 1 in diagram below)Gene encodingprotein XBoth the reported gene construct and plasmids with DNA encoding wild-type or mutant (deleted) Gal4were simultaneously introduced into mutant (gal4) yeast cells. (See schematic below)Plasmid12 activities were measured: In vitro binding (+ or -) to the reporter using EMSA's and the ability oftruncated proteins to activate transcription via production of reporter gene (B-gal activity) levels.X-bindingsiteNucleusDiReporterUAS GALgenePlasmidProtein XTATAboxReporter-genetranscripts(b) Wild-type and mutant Gal4 proteinsBindingto UAS GALWild typeDeletionconstructs1234lacz gene5501 741 74881692881755738881B-Galactosidaseactivity++++++

Name: Based on the data shown where is the DNA binding domain? Explain whic
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Based on the data shown where is the DNA binding domain? Explain which constructs helped you reach this conclusion? Which part of the protein is the Activation domain? Explain which constructs helped you reach your conclusion? The schematic (a)bel

The given scenario involves the study of a reporter-gene construct containing a lacZ reporter gene…

Science

Biology

Based on the data shown where is the DNA binding domain? Explain which constructs helped you reach this conclusion? Which part of the protein is the Activation domain? Explain which constructs helped you reach your conclusion?

Based on the data shown where is the DNA binding domain? Explain which constructs helped you reach this conclusion? Which part of the protein is the Activation domain? Explain which constructs helped you reach your conclusion?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 13QP

See similar textbooks

Similar questions

You would like to add a nuclear localization sequence (NLS) of Lys-Lys-Lys-Arg-Lys to a protein that is usually found in the cytoplasm of a yeast cell. To accomplish this, you introduce the nucleotide sequence encoding the NLS into the gene that encodes the cytoplasmic protein of interest. a. What is the size of the nucleotide insert that will encode the NLS? Briefly explain. 5' 3' b. Below is a diagram of the gene encoding the cytoplasmic protein of interest in the yeast genome. If your goal is to put the NLS at the carboxyl (C) terminus of the protein, at which location (A-E) should the NLS be inserted? Briefly explain. A TATAA ATATT promoter +1 B ATG TAC D TAA ATT stop codon E 3' 5'
The following logo plot represents the preferred cis-regulatory sequences (i.e. transcription factor binding site) of bHLH transcription factor FOSL1. C 1 2 3 4 5 6 7 8 9 10 11 position Would you expect this sequence to be recognized by a monomer, a homodimer, or a heterodimer of the protein? Explain your answer. (short phrases are sufficient; please write your answer into the template below) A- В I A -l expect FOSL1 to bind as a: (monomer, homodimer, heterodimer; please choose) B - short explanation: information content (bit) !!
Shown below is a schematic diagram illustrating a very short gene with 5000 bp region of an unknown Schizosaccharomyces pombe genome. (Note: Transcription starts at Transcription Start Site (TSS).) TSS 5. 3' 3 +1 (i) Name the specific regions that can be recognized by Transcription Factor IID (TF ID) and indicate the locations in the diagram above. (ii) List the mechanistic steps that can trigger the initiation of transcription by Transcription Factor IIH (TF IIH).
An electrophoretic mobility shift assay can be used to study the binding of proteins to a segment of DNA. In the results shown here, an EMSA was used to examine the requirements for the binding of RNA polymerase |l (from eukaryotic cells) to the promoter of a protein-encoding gene. The assembly of general transcription factors and RNA polymerase Il at the core promoter is described in Week 4. In this experiment, the segment of DNA containing a promoter sequence was 1100 bp in length. The fragment was mixed with various combinations of proteins and then subjected to an EMSA. Lane 1: No proteins added Lane 2: TFIID Lane 3: TFIIB Lane 4: RNA polymerase IIl Lane 5: TFIID + TFIIB Lane 6: TFIID + RNA 1 2 3 4 5 6. 7 polymerase II Lane 7: TFIID + TFIIB + RNA polymerase Il 1100 bp Explain the results.
(c) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to suppress syn- thesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix – (reverse) turn – helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein, a different type of repressor protein. A diagram of the trp repressor dimer is also shown. reverse turn trp helix 4 70 Trp -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly- Ile- Prl -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr- Val- Pri heilix trp helix 5 80 90 Trp Ala-Thr-Ile-Thr-Arg-Gly-Ser sgn-Ser-Leu-Lys-Ala-Ala- Prl Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- Prl helix
You are teaching a class on the regulation of eukaryotic gene expression. In order to demonstrate this complex process, you decide to draw for the class a typical eukaryotic gene/transcription unit with its major regions, such as the promoter regions, where the RNA polymerase II and transcription factors would bind From the list given - choose all components that you think are part of a typical eukaryotic gene From the list given - choose all the regulatory sequences that you think would control the expression of this eukaryotic gene From the list given - choose all of the regulatory proteins that would bind the eukaryotic gene to control its expression
The IMD2 promoter contains three upstream transcription start sites (TSS) that are utilized under high GTP conditions and a single downstream TSS (-106) that is normally only utilized under low GTP conditions. In a wild type cell, expression of IMD2 mRNA only occurs if transcription initiates from the -106 TSS. In 300 words or less, describe: 1.) The normal function of Ssl2, and 2.) why a mutation in Ssl2, that increases its catalytic rate, would allow expression of the IMD2 ORF under high GTP conditions. (Conditions under which the IMD2 ORF is NOT expressed in the wild type.)
a) The best vector to use determine receptor binding protein expression would have been one with a GFP gene (green flourescent protein) attached. State one (1) reason why including this gene would have made the experiment easier and whether you have inserted the receptor binding domain gene before or after the GFP gene. b) You wish to determine the sucess pf your transformation by detecting the presence of receptor binding domian mRNA. Describe the key steps of the hybrdization technique you would use, clearly stating how you would design the probe to detect your receptor mRNA.
. Another class of suppressor mutations, not describedin the chapter, are mutations that suppress missensemutations.a. Why would bacterial strains carrying such missense suppressor mutations generally grow moreslowly than strains carrying nonsense suppressormutations?b. What other kinds of mutations can you imagine ingenes encoding components needed for gene expression that would suppress a missense mutationin a protein-coding gene?
You made four mutants for a promoter sequence in DNA and studied them for transcription. The results of the amount of gene expression or transcription (based on beta-Gal activity shown on Y-axis) for these DNAs (X-axis) are shown. The sequence of the wild-type and mutant DNAs, and consensus sequence from many promoters are shown here for your convenience. From this experiment you can conclude that: Nucleotide substitution can identify important bases of the binding sites or promoter in DNA (e.g., -10 and -35 promoter sequences of lac operon). True or false: Spacer (a) -10 region -35 region TTGACA Consensus sequence TATAAT Wild-type Lac promoter GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATT Mutant 1 GGCTTTACACTTTATG-TTCCGGCTCGTATGTTGTGTGGAATT Mutant 2 GGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATT Mutant 3 GGCTTTACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT Mutant 4 GGCTTGACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT (b) 700 600- 500- 400- 300- 200- 100. 0 ● True O False B-Galactosidase activity Wild-type…
GR and PPAR are transcription factors that bind to GRE and PPARE sequences respectively and activate transcription of genes. A reporter cell line is created in which the the green fluoresecent protein (GFP) is controlled by a GRE sequence and the pink fluorescent protein mCherry is under control of a PPARE sequence. If the gene for GR is introduced into the reporter cell line, the cells produce a green color. Chimeric proteins are created in which the DNA Binding Domains (DBD) and Activation Domains (AD) of the transcription factors are introduced into various cell lines. Match the following cell-types with the fluorescent color(s) you would expect the cells to produce.
Suppose you have a 1-kb segment of cloned DNA that is suspected to contain a eukaryotic promoter including a TATA box, a CAT box, and an upstream GC-rich sequence. The clone also contains a gene whose transcript is readily detectable. Your laboratory supervisor asks you to outline an experiment. (1) determine if eukaryotic transcription factors (TF) bind to the fragment and, if so, (2) identify where on the fragment the transcription factors bind. All necessary reagents, equipment, and experimental know-how are available in the laboratory. Complete the outline of an experiment, which determines if eukaryotic transcription factors (TF) bind to the fragment. Assume all necessary reagents, equipment, and experimental how are available in the laboratory. Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Not all terms will be used. For the band shift assay, two samples of the DNA fragment are analyzed by agarose gel electrophoresis: one sample is…