Q: How many genes in human body (either active and inert)?
A: Genes are DNA sequences that code for specific traits. They are the basic physical and functional…
Q: Will an insertion or a deletion of three nucleotides result in a frameshift mutation? Explain why or…
A: The frameshift mutation is the mutation by which the amino acid frame is changed. It is usually…
Q: "The molecule serving as the genetic material is expected to absorb at the wavelengths shown to be…
A: DNA is a double-stranded molecule with helical structure. It has made of nucleotides containing four…
Q: What are the best available databases for identification of alternatively spliced isoforms in human…
A: Genome sequencing means to determine the whole DNA sequence of the particular organism like the…
Q: If the MC1R protein is 317 amino acids long, why are there 954 base pairs in the coding region of…
A: The proteins are produced by the amino acids that are produced by the translation process. During…
Q: Although DNA transposons are abundant in the genomes of multicellular eukaryotes, class 1 elements…
A: Transposons are called jumping genes they change their position within a Genome.
Q: What is the significance of the terminal inverted repeats oftransposons?
A: Transposons are the sequences of the nucleotides in the genome that have the ability to change their…
Q: Briefly explain the frameshift mutation ?
A: Mutation can be defined as the change that occurs in the DNA sequence which is caused by mistake or…
Q: What proportion of exons are repeated sequences in the human genome? Is 38% surprising?
A: Human Genome is comprised of only 1.1% exons of the total, whereas 24% is in introns, and the…
Q: How many different dna fragments would you expect to obtain if you cleaved human genomic dna with…
A: The cell is the fundamental unit of life. The nucleus part of the cell contains Deoxyribonucleic…
Q: Your PhD thesis advisor has given you the task of preparing a human genomic DNA library. 3a. How…
A: The length of the human genome is approximately 3.2 billion bases with genes of 20000-25000 protein…
Q: Why is the term “proteome” ambiguous, whereas the term“genome” is not?
A: The proteins are the essential part of living organisms and it consists of thousands of smaller…
Q: How many units (U) of EcoR1 did you use in the digestion? How much lambda DNA (in ugs) was digested…
A: DNA-cutting enzymes are restriction enzymes. Each enzyme recognises a single or a few target…
Q: How were the specific sequences of triplet codes determined experimentally?
A: The DNA genetic code comprises a set of rules and instructions to obtain proteins and molecules…
Q: Identify the conditions that account for the differentseasons
A: The period of a year that is characterized from others by some characteristic climatic conditions…
Q: What causes trinucleotide repeat expansion?
A: Trinucleotide repeat expansion or triplet repeat expansion refers to the mutation of DNA consisting…
Q: If the mutation causing Tay Sachs disease involves a C to T change at position 4 in the sequence…
A: Gene probes are of three types: gene-specific probes, polymorphic probes and oligonucleotide probes.…
Q: Approximately what percentage of the human genome isderived from transposable elements?a. 10%b.…
A: Introduction:- Transposable elements are DNA sequences that have the ability to travel or transfer…
Q: Approximately what portion of the human genome is composed of repeat sequences?
A: According to the results found in the human genome studies it is seen that the human genome has…
Q: How many restriction fragment length polymorphisms are there in the humangenome?
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: What is the significance that the cleavage site is 10-base-pairs long?
A: Biomolecules are organic molecules that occur and function in living systems. They include…
Q: How many transposons are in the human genome?
A: Transposons or transposable elements (TE) are the DNA (deoxyribonucleic acid) sequences that can…
Q: On the basis of current knowledge, the protein-encoding regions account for only about 3% of the…
A: The Central Dogma of molecular biology states that: DNA makes RNA, which makes Proteins. However, a…
Q: What are base analogs and why are they mutagenic?
A: Introduction :- A mutagen is a substance that can cause DNA mutations by chemical or physical means.…
Q: how are okazaki fragments created?
A: An Okazaki fragment refers to DNA fragments that are formed during the DNA replication process.
Q: Briefly explain why CpG islands might have come to be underrepresented in eukaryotic genomes.
A: CpG islands are the sites of methylation on DNA. Methylation of DNA occurs to silence some genes of…
Q: Basic features of the central dogma of molecular genetics is
A: DNA is a molecule made up of two polynucleotide chains that form a double helix and carry genetic…
Q: How base tautomerization causes mutation?
A: Mutations are changes that occurs in the deoxyribonucleic acid (DNA) sequence, either due to…
Q: 6a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…
A: DNA (deoxyribonucleic acid) often experience changes as a result of replication errors or…
Q: Do the many “dead” transposonsin the human genome provide anybenefits to humans?
A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA. A…
Q: What are frame-shift insertion?
A: Mutations are changes that occurs in the deoxyribonucleic acid (DNA) sequence, either due to…
Q: Would you be more likely to find single nucleotidepolymorphisms (SNPs) in the protein-coding or in…
A: Single nucleotide polymorphisms in short SNPs refer to the variation in a single base pair that…
Q: Describe the central dogma of molecular biology.With regards to DNA, what is supercoiling and what…
A: Replication is the reason for organic legacy. It duplicates a cell's DNA. The chemical Deoxyribose…
Q: Homologous recombination in E. coli forms heteroduplex regions of DNA containing mismatched bases.…
A: Heteroduplex : It is a double stranded molecule of nucleic acid originated through the genetic…
Q: What are homologous sequences? What is the difference between orthologs and paralogs?
A: Sequences - Sequences are defined as the linear arrangement and order of the nitrogenous bases in…
Q: Given the Percentage Composition of One Nucleotide ina Genome, Can We Predict the Percentages of the…
A: Nucleotides are the chemical compounds that constitute the nucleic acids. The nucleic acids are of…
Q: What feature of the –10 sequence makes it easy to unwind?
A: Pribnow box, or -10 sequence represents the six-nucleotide-sequence TATAAT. This sequence is a…
Q: What is the central dogma of biology? Describe the molecular processes that accomplish the flow of…
A: Central Dogma of Biology: The flow of genetic information from DNA to RNA which is…
Q: What is the importance of proteins for living beings? What is the name of the DNA duplication…
A: Protein is a macronutrient that is essential to building muscle mass,It is commonly found in animal…
Q: In genetic transformation, what is meant by the wordcompetence?
A: The process of taking up naked or foreign deoxyribonucleic acid (DNA) from the environment is called…
Q: What fraction of the human genome consists of transposons and retrotransposons?
A: Transposons are also known as jumping genes. Such genes are able to change the position anywhere in…
Q: The human genome contains thousands of sequences known as small open reading frames, some of which…
A: Deoxyribonucleic acid (DNA) is a genetic material and it carries genetic information from one cell…
Q: What key molecules are essential for Sanger sequencing?
A: DNA sequencing is used to determine the exact arrangement of the nucleotide bases adenine (A),…
Q: Nearly _______of the Human GenomeConsists of Transposable Elements?
A: The transposable elements are the DNA sequence that may change its position or location within the…
Approximately how many Okazaki fragments are synthesized in the
replication of the human genome?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving human DNA with Haeiii in such a way that the DNA is only partially digested; that is, not all the possible HaeIII sites have been cleaved. What is a possible reason for doing this?The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…What proportion of exons are repeated sequences in the human genome? Is 38% surprising?
- Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics? (Explain in details)Silent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provideanswers for the following questions?1) Define the silent mutation in DNA? (2.5 marks)2) What is the codon usage bias? (2.5 marks)3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect onthe phenotype and provide a brief description of its molecular characteristics? (10.0 marks)Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a "silent mutation" that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?
- Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics?Describe the outcome of a chain-terminator sequencing procedure in which (a) too few primers are present or (b) an excess of primers is present.how are okazaki fragments created?
- Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'What is Kozak sequence ? who invented this ?1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…
