An allergy can best be defined as ______. A) a component of the humoral response B) an exaggerated response to an allergen C) part of the normal immune response D) a type of cell-mediated adaptive immunity

An allergy can best be defined as ______. A) a component of the humoral response B) an exaggerated response to an allergen C) part of the normal immune response D) a type of cell-mediated adaptive immunity

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter9: Immunity And Disease

Section: Chapter Questions

Problem 4RQ: What is the difference between an allergy and an autoimmune response?

See similar textbooks

Related questions

Q: Having a prenegotiation meeting in the Mushroom simulation is a form of Oe) Authority power O a)…

A: ANSWER) Intra-organizational bargaining is the meeting held within the organisation by considering…

Q: 6.c. Mutated DNA Template Strand #3: 3'-TACTGAC TGACTATC-5' Complementary DNA sequence: mRNA…

A: The mutation is the change in the base sequence of the DNA nucleotide sequence or a gene. The…

Q: woll bevange snow done to letmin & tibong maistups-miedomibase 5. You want to treat a 15-acre field…

A: The total area for which Lexar EZ 3.7SC is to applied is 15 acres. Rate of application is 3…

Q: Use the following information to answer the next question. Life Cycle of a Butterfly Adult…

A: Nondisjunction in meiosis II comes from the failure of the sister chromatids to split during…

Q: 5. A patient receives a donor kidney to replace diseased kidney tissue. Consider and answer the…

A: Cytotoxic T cells * MHC restricted * Antigen specific *Belong to adaptive immunity * Requires…

Q: How does position effect influence gene expression? TI The movement y! CDC The movement of the…

A: ANSWER : The correct option is: All of the above answers are correct

Q: Agrobacterium tumefaciens is ... Question 61 options: a family of transposable elements found…

A: Genetic engineering is a process in which genetic makeup of an organism altered by introduction of…

Q: Finally, you assess the whole skeleton for trauma and find 3 fractures and a gun shot wound. What…

A: The human skeletal system consists of 206 bones. Of these 80 bones belong to the axial skeleton…

Q: Which of the following is a viral disease that destroys the immune system? A) anemia B) HIV-AIDS C)…

A: Anemia is a condition in which there is a deficiency of red cells or of haemoglobin in the blood and…

Q: Discuss the differences between saturated fatty acids, cis unsaturated fatty acids, and trans fatty…

A: Fatty acids contains a carboxylic acid with an aliphatic chain that may be saturated or unsaturated.…

Q: If you perform a Chi-Squared analysis and determine that your result is greater than the critical…

A: Ans: Chi- square analysis is a statistical hypothesis test to determine the relationship between the…

Q: Describe the morphology of radular teeth in the Gastropoda species

A: Introduction The radula is the vital feeding organ and also very significant to the majority of…

Q: Relaman has suffered from high fever and Doctor diagnosed it as Typhoid which microorganism infected…

A: Typhoid It is an infection that spreads through the consumption of contaminated food and water.…

Q: Describe Scientific Method

A: A research proposal is a document that specifies the aims of the research and the techniques that…

Q: Your short answer should be 2-5 sentences depending on the question. (Ch. 54). Please answer both…

A: In a biological community, there are a variety of colonies of different species coexisting in close…

Q: Which of the following is part of the extracellular matrix? Group of answer choices A) All of the…

A: The extracellular matrix fills the spaces between cells and binds cells and tissues together. It…

Q: Q2 (a) In 2014, during their iGEM project on biodesalination, students were willing to modify…

A: There are perform a restriction digestion process by restriction endonuclease PstI which recognize…

Q: Question 24 Proximal tubule balance is a passive process that explains increased sodium and water…

A: The filtered load of all solutes, including glucose, amino acids, and other solutes absorbed by Na+…

Q: How to improve the insulin pump “t:slim”, its effectiveness and transport ?

A: The t:slim X2 insulin pump is a smart gadget that releases insulin into the body automatically. It…

Q: ACTIVITY 2: Protein Synthesis DNA: 3' A G C C G T A GA AТТ 5' 1. Using this strand of DNA as a…

A: Cells create proteins through a mechanism known as protein synthesis. Transcription and translation…

Q: 1.Where will a bacteria grow best: glucose, malonate, or gluconate? Explain your answer…

A: Culture media is a gel or liquid that contains nutrients and is used to grow bacteria or…

Q: DNA is alway DNA mRNA 5' aal 3 51 PROMOTER AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC…

A: One of the core concepts of molecular biology is the flow of information from DNA to RNA to…

Q: Which of the following statements best characterizes genetic diversity in humans? 1.) There are far…

A: Introduction:- Biological diversity is defined as the various different types of life or living…

Q: Which statement is true of viral replication? A) virus attaches to a specific receptor site on…

A: A virus is a non-cellular, infectious entity that is minuscule in size and can survive by surviving…

Q: Name the specific blood vessels which supply oxygenated blood and collect deoxygenated blood from…

Q: In this activity, you will: 1. Observe life forms other than those you studied from Grades 3 through…

A: This activity is about different types of living beings. Living beings carry out various life…

Q: Fill in the gap with correct answers: 1. Obligate anaerobes cannot grow (and usually die)…

A: Before the onset of any process, the biological system gets ready for it to overcome the situation…

Q: question: Can you summarize and explain for me what you want to tell in the article below? When I…

A: The given article is about Nanomaterial-Based Vaccine Development and Immunomodulation for COVID-19…

Q: Put the steps of the process of signal transduction in the order they occur (hint - try to decide…

A: The receptors have site for binding of specific ligand. The receptors are of two types: Membrane…

Q: Explain why infections caused by fungi, protozoans, and helminths are more difficult to treat than…

A: Introduction : Infection is the entry of the pathogen or infectious agent that causes the disease…

Q: is false because while it is true that land conversion may reduce some risks associated with disease…

A: The option A is incorrect because drought- and heat-induced increase of wildfires can have…

Q: Can you summarize and explain for me what you want to tell in the article below? When I read it…

A: The above article describes about the Interference with Cellular Uptake, Immobilization, and…

Q: The next several questions refer to the data given in this problem. You sample a population of…

A: The prevalence of a gene variant in a population is represented by the allele frequency. Alleles are…

Q: Patrick the starfish and his friend Susie the sand dollar are both members of the

A: Patric the starfish and Suie the sand dollar are anime characters from the animated series SpongeBob…

Q: Connective tissue comes in a variety of types. Explain how variations in this tissue type help to…

A: Connective tissue is widely distributed as well as one of most abundant tissue in our body. It is…

Q: Instructions Explain 1 way each of the following can occur. In your answer, say whether non-…

A: the sperm carries Y, so non-disjunction occurs in mother, If the X chromosomes failed to separate…

Q: Use the following information to answer the next question. A bacterium has been found that…

A: According to Bartleby guidelines a single question or in the case of question having subparts,…

Q: How has the significance of science knowledge changed over the centuries from the point of view of…

A: Scientific knowledge is crucial to our understanding of the world around us and how it works. It…

Q: Site of transcription Choose a match

A: All of the given matches are correct but Transcription takes place in the nucleus. An RNA…

Q: Proteins that bind to a specific DNA sequence and help control the recruitment of RNA polymerase are…

A: DNA, or the deoxyribonucleic acid, is basically the hereditary material in humans and almost all…

Q: The principles of biomimicry and bioinspiration have been used to design and to engineer…

A: To cope with the complexity of the body and to evade the multiple layers of defense that tissues and…

Q: A newly discovered gene has th 4.08 2.54 el H H 1.02 ↓ E E 1.67 E 10.8 kbp 3.94 3.66 H 10.811 E E…

A: (a) A method used frequently in labs to separate charged molecules like DNA, RNA, and proteins is…

Q: Which of the following statements is false about the impacts of climate change? Choose all that…

A: Climate change is having a wide range of impacts on the environment, including increased…

Q: What hormones are involved in renal functions, and what 2 systems, ultimately what affects water…

A: The kidneys assist in maintaining the body's fluid balance by filtering the blood. Small tubules in…

Q: Chloroplast genomes have sequence homology to cyanobacteria genomes. (True or false)

A: Sequence homology is a concept used in molecular biology and biochemistry to describe the degree of…

Q: A population of bats becomes isolated after colonizing an island, developing a high incidence of a…

A: The population is the group of individuals belonging to the same species and able to interbreed.…

Q: Targeted metagenomics is helping researchers better understand the complex connectios between diet,…

A: As we can see in the pie charts that Bacteriodetes make 35.44% in patients without cekiac disease…

Q: When you cross a female carrier for Color Blindness XCXc with a Color Blind male XcY, what is the…

A: An imbalance in how one or more light-sensitive cells (known as cones) located in the retina of the…

Q: Which of the following types of enzymes is primarily responsible for setting up the genetic code?…

A: Enzymes are the biocatalyst ,which increases the rate of chemical reactions in the body.Most of the…

Q: Did studying genetics help you change your perspective about what a human is

A: Genetics It refers to the study of genes and heredity. Heredity refers to the passing of genetic…

Concept explainers

Immune Disorders

The collaboration between the cells and proteins that work together as a defense system against infection comprises the immune system.Each of them performs a variety of tasks to recognize and/or react against a foreign body.

Question

100%

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Explanation

VIEW

Answer

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

While you are jogging carly in the moming, you slip on some ice and skin your knee. Following the breach in skin, which of the following MIGHT be expected? a) Release of histamine, prostaglandins and leukotrienes b) Extravasation of neutrophils c) Complement activation d) ONLY a & b e) All of the Above
Delayed-type hypersensitivity reactions in the skina) are characterized by a wheal and flare reaction.b) peak at 4 to 6 hours after exposure to antigen.c) require complement activation.d) show induration because of the influx of sensitized T cells and macrophages.e) depend on activities of the Fc portion of antibodies.
Innate lymphoid cells reside primarily in tissues such as the lungs, the lining of the gastrointestinal tract, and the skin, because these sites represent the major routes of entry of pathogens into the body. Several different subsets of innate lymphoid cells exist, and each is specialized to respond to a category of pathogen (e.g., viruses, extracellular bacteria, helminthic parasites, etc). a) True b) False
The correct order of words to describe how innate immune response responds to a pathogen that has gotten by the physical and chemical barriers is: À) Skin, Saliva, Cytokines, Macrophage B)Macrophage, Cytokines, Neutrophil, Natural Killer Cell C) Neutrophil, Cytokines, Killer T Cell, Antibodies D) Antigen, Macrophage, B Cell, Killer T Cell
The benefit of specific immunity is the production of ________ that provide long-lasting protection. A) antibodies B) plasma cells C) T helper cells D) memory cells
An allergic reaction is an example of: a) the immune system not working at all. b) a deficiency of B cell responses. c) the immune system doing its job too well. d) an overabundance of T cell responses.
Which of the following components of the immune system recognizes pathogen-associated molecular patterns? a.) Macrophages b.) Dendritic cells c.) Proteins of the complement system d.) All of above
Which form of acquired immunity is the patient developing by having this infection? A) Active natural immunity B) Passive natural immunity C) Active artificial immunity D) Passive artificial immunity
What is the role of histamine in inflammation? A)Histamine increases the volume of blood flow in the area of the infection. B)All these choices are correct. C)Histamine signals to neutrophils to migrate to the site of infection. D)Histamine makes it easier for neutrophils to move from the bloodstream to the site of infection.
Severe sepsis is a major cause of postoperative morbidity and mortality. What could contribute to the high incidence of postoperative sepsis. a.) No postoperative antibiotics given b.) Lack of feedback inhibition to the immune system by the HPA axis c.) Autoimmune activity d.) Suppression of innate and cell-mediated immunity
A deficiency of both B cells and T cells is most likely a(n)... a)secondary immunodeficiency b)complex immunodeficiency c)acquired immunodeficiency d)primary immunodeficiency e)induced immunodeficiency
Which of the following is a characteristic of humoral immunity? Question 9 options: A) The cells originate in the thymus. B) The cells are most effective against intracellular pathogens. C) Humoral immune cells inhibit the immune response. D) Humoral cells make antibodies.