Although all of the DNA in the human genome may be important for gene regulation or other functions, the amount of DNA that is actually part of the coding regions for proteins is less than 2% about 50% 26.4% only about 90%

Although all of the DNA in the human genome may be important for gene regulation or other functions, the amount of DNA that is actually part of the coding regions for proteins is less than 2% about 50% 26.4% only about 90%

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 11QP: When the human genome sequence was finally completed, scientists were surprised to discover that the...

See similar textbooks

Related questions

Q: The length of the SURF1 gene is 15, 914 bases. This gene is comprised of 11 exons and 10 introns.…

A: Ans. The gene has specific sequences which are important for the transcription of the gene. One of…

Q: The length of the SURF1 gene is 15, 914 bases. This gene is comprised of 11 exons and 10 introns.…

A: In the diagram shown SURF1 gene. SURF1 gene is present at 9th chromosome & produces surf…

Q: Perfect Day Foods is one company creating a synthetic milk alternative. It's similar to milk in that…

A: Introduction Redefining dairy product proteins is an alternative taken to produce the same taste and…

Q: Which of the following DNA regulatory protein “motifs” consists of three a-helices, in a single…

A: Deoxyribonucleic acid (DNA) binding proteins are proteins that attach to ss or ds DNA. These…

Q: Which one of the following statements is true? Select one: O a. Each gene codes for three proteins O…

A: In order to form proteins, DNA codes for m RNA and t RNA through the process of transcription. Both…

Q: DNA from a eukaryotic gene was isolated, denatured, and hybridized to the mRNA transcribed from the…

A: The flow of biological information in the living being is that the DNA makes RNA and then RNA makes…

Q: which one would be least likely to cause Liam’s disease? Group of answer choices A. Mutation 4 B.…

A: Promoter: Is short nucleotides sequences located at 5'end that aid in switching on and off of a…

Q: A 2500 bp region of the human genome encodes two genes. One of the genes encodes a protein of 600…

A: Adenine, Guanine, Thymine and Cytosine are the base pairs which are present in DNA and in RNA Uracil…

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…

A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…

Q: Which one of the following is correct concerning the genetic code? a triplet code always…

A: Introduction: The genetic code is defined as the structure of nitrogen bases and mRNA molecule which…

Q: What was the Mendel’s definition of a gene? How was it different from the definition by Beadle and…

A: Please note that keeping with regulations the first 3 questions (actually 5) are answered below,…

Q: An RNA sequence includes 15 bases. How many amino acids does this sequence encode? 3 0 5 O 15 O 45

A: RNA is a molecule that consists of a single strand of nucleotides. It is a product of transcription…

Q: You are working in a research lab that is surveying the CFTR gene sequence in humans to identify new…

A: A synonymous mutation is mutation in the DNA sequence that leads to change in the codon for amino…

Q: The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that…

A: The genetic framework is a collection of instructions used by living cells to decipher data encoded…

Q: Some mutations affect changes in protein structure and function that can result in disease whereas…

A: Proteins are synthesized from gene expression. They are coded by the genes and translated to form…

Q: Exon duplication of multiple alpha-helix coding domains is thought to be responsible for the origin…

A: Vertebrates have spinal cord which remain surrounded by bone or cartilage. Mammals are vertebrate…

Q: All the cells of one organism share the same genome. However, during development, some cells develop…

A: Developmental biology and stem cell biology helps us to understand more about the fate of cells. The…

Q: Beadle and Tatum's experiments led to the "one gene - one enzyme (protein)" hypothesis. In…

A: The genes are the functional part of the DNA that are responsible for the production of RNA by the…

Q: Which of the following are affected by changes in DNA methylation? Choose all that apply. The…

A: DNA methylation is defined as a process by which a methyl group is added to the structure of a DNA…

Q: Shown below is the genomic structure of the wild-type gene for the human gene transthyretin. The…

A: Introduction: A nucleotide is an organic molecule that is the building block of DNA and RNA. They…

Q: How many genes in the human genome code for lipids instead of proteins? A. 0 B. Approx. 1000 C.…

A: Lipids are either derived from the diet or synthesized inside the human body from fatty acid…

Q: nucleotide is in the left column, and second codon nucleotide is on top. The m allele sequences are…

A: Sense strand of the coding strand is the segment of DNA that carries the code that can be…

Q: The human genome has 3.3 billion bases, of which 3% codes for protein. If a codon were four letters…

A: In most organisms, genetic information is stored in the form of the nucleotide sequence of DNA. This…

Q: Which of the following statements is TRUE of highly repetitive sequences? O They can be found…

A: ANSWER;- a)They can be found millions of times in a eukaryotic genome. Explain;- DNA sequences…

Q: The mass of RNA that has copied a segment of DNA is 63,000 units. The RNA mass that is placed in the…

A: Here, first we have to calculate the RNA units that will be used for peptide synthesis so, 60% 0f…

Q: Which of the following biological questions could be examined by CHIP-seq? DNA sequences that are…

A: Option 5 is the answer. CHIP -seq is a tool used to study proteins that are bound to DNA. CHIP-seq…

Q: Why do humans have such a large number of nucleotides (3.2 billion base pairs) compared to the…

A: The genome is the sum total of all genetic material of an organism which stores biological…

Q: The mass of mRNA that has copied a segment of DNA is 36,000 units, the mRNA is placed in the…

A: The process in which protein is produced from mRNA with the help of tRNA and ribosome, called…

Q: Why are RNA viruses more likely to mutate than those that have genomes made of DNA? 2.What would…

A: Viruses generally have genetic material, either DNA or RNA inside a coat of proteins and…

Q: Which of the following is true regarding the human genome? SİRNA prevents LINE element expansion by…

A: Human genome is composed of coding and noncoding DNA sequences and is 3.5 billion base pairs long.

Q: many more mRNA transcripts than there are genes. Why isn’t the number the same?

A: Regulatory protein (or gene-regulatory protein) is any protein that controls the transcription.…

Q: What are the classes of mutations that can be made in the genetic code? In your own words describe…

A: Proteins are important for the normal functioning of the human body. Proteins are made of amino…

Q: What fraction of transcription in most human cells corresponds to non-coding RNAS? 20% 1096 100% 0%…

A: Non-coding RNAs (ncRNAs) capacity to direct quality articulation at the transcriptional and…

Q: Which of the following is/are true? 1. Oils are different from fats because they are plant derived…

A: Oils are different from fats because they are plant derived and mostly contain unsaturaded fatty…

Q: ow that the human genome has been sequenced, we know that there are fewer than expected protein…

A: The genomes of most eukaryotes including Humans are larger and complex than those of prokaryotes.…

Q: RNA are extracted from liver cells and separated in agarose gel by electrophoresis side-by-side with…

A: Biotechnology is the part of applied science that utilizations living organic entities and their…

Q: Base substitutions in a gene exon might not result in a change in the gene product because…

A: More than one codon specifies a single amino acid. That is why the protein sequence might not get…

Q: The mass of a gene is 32,400 units. The amount of introns is twice the amount of exons. What is the…

A: mass of gene = x * 300 + 2x * 300 = 32,400x = amount of exon , 2x = amount of introns 300x + 600x…

Q: Which of the following would be classified as non-coding DNA? (mark all applicable answers) The…

A: Non coding DNA are sequences of DNA that do not code for proteins.

Q: The sequence of subunits in a DNA molecule is more important to its function than the number of…

A: DNA instructions are translated into functional products using a 'Central Dogma'. The central dogma…

Q: an adult with a history of tanning has his genome sequenced. The beginning of a protein coding…

A: Mutations are the changes in the genetic sequence that may result in genotypic or phenotypic…

Q: The protein neuroD is a critical human protein translated in the brain during development. The…

Q: On Figure , indicate the locations of the promoters and terminators for genes a, b, and c.

A: Gene is the structural and functional unit in the DNA. Genes are composed of nucleotide nitrogenous…

Q: egments of a DNA molecule that are transcribed, but do not contain the codes for amino acids in that…

A: A gene is the basic physical and functional unit of heredity. Genes are made up of DNA and each…

Q: The complete set of RNA transcripts present in a cell under various conditions is called the: a)…

A: Different molecules present inside a cell can be studied by different approaches.

Q: You may have left high school thinking that the definition of a gene is: "a sequence of DNA that…

A: Please find the answer in step2:

Q: Which of the following statements is NOT TRUE

A: Answer is- All of the above are true

Question

Although all of the DNA in the human genome may be important for gene regulation or other
functions, the amount of DNA that is actually part of the coding regions for proteins is
less than 2%
about 50%
26.4%
only about 90%

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction

VIEW

Step 2: Answer

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
When the human genome sequence was finally completed, scientists were surprised to discover that the genome contains far fewer genes than expected. How many genes are present in the human genome? Scientists have also found that there are many more different kinds of proteins in human cells than there are different genes in the genome. How can this be explained?
8) Which of the following best describes why it is possible for the bacteria to read the instructions in a human gene and produce a human protein as a result? Bacterial cells and human cells are identical and contain the same organelles Bacterial cells and human cells both use DNA to store their genetic information The genetic code is universal - the same codon codes for the same amino acid in all species The bacterial cell already contains a gene that is very similar to the human growth hormone gene
Milk is secreted by the cells of the mammary glands. Casein is the main protein found in milk. It is coded by a gene ofa known sequence of nucleotide. In some human females, their mammary glands secrete non functional casein. The following document presents a part of the transcribed gene that codes for functional and nonfunctional casein. Codon number Nucleotide Sequence 1 TAC ТАС 3 4 CTT CTT TTG TTG СТС AAT Functional casein Nonfunctional casein TTC AAT TTC CTC AAT АTT Document 2 4- Write using the genetic code table, the amino acids sequence of the two types of casein proteins coded by the above nucleotide sequence. 5-1-Compare the nucleotide sequence coding for the 2 types of casein protein and the amino acids sequence coded by these nucleotide sequences. 5-2-Draw out the origin of producing non-functional protein.
Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then translated into amino acids. Complete the DNA-to-amino acid table for three consecutive codons with the appropriate nucleotides and amino acids using a codon table. Nucleotide and amino acid options can be used multiple times or not at all. 5' to 3' DNA strand 3' to 5' DNA strand transcribed mRNA tRNA anticodon amino acid arginine cysteine leucine T A U A T G A U arginine leucine A proline T A U Answer Bank A G G с с T T A A U glutamic acid U G C G с с glutamic acid G G G с с G C arginine C G с G
A Section of a GeneAAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: mRNA codons tRNA anticodons amino acids The section of a gene shown above (AAG ATA CAG GCT CGG TAA) is called the Answer (template or non-template) strand. It is also known as the Answer (sense or antisense) strand. The amino acids are determined from the Answer (DNA or mRNA or tRNA) strand
Which of the following mutations would be most likely to have the most negative effect on the functioning of a protein produced by the gene? Group of answer choices a deletion of one nucleotide at the beginning of the coding sequence a substitution of one nucleotide at the beginning of the coding sequence an insertion of three nucleotides near the end of the coding sequence a substitution of one nucleotide near the end of the coding sequence
The following is the DNA sequence of the entire protein-coding region for some small gene in a eukaryote. Shown is the coding strand. The first row is the original sequence with no mutations. Subsequent rows represent a single mutation. Mutation DNA Sequence None 5' ..A TGGGCGAGGT ATTATA G.. 3 5' ..A TGGGCGAGAT AT TA TA G.. 3' 5' ..A TGGGCGAG GTA CTATA G.. 3' C 5'..A TG GCCGAGG TATTATA G.. 3' The region without a mutation is transcribed, and then translated. Give the protein that is translated from this section of DNA. Use the single letter abbriviations for amino acids with no spaces. N- -C Determine the molecular basis for each mutation and what effect there would on the protein. Mutation Molecular Basis Effect on Protein
1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA strand sequence from which it was transcribe 2. List the complementary non-coding DNA Sequence 3. List the Amino acid Sequence of the protein coded for. Use the Genetic Code 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA. 5'- TACCATGAGAATTGTGG TCACCTTTTT-3' 3'- ATGGTACTCTTAACACCAGTGGAAAA A-5' MRNA Sequence Amino Acid Sequence
A strand of DNA is composed of: A 30%, T 15%, G35%, and C 20%. What is the composition of the complimentary mRNA strand? A 30%, T 15%, G35%, and C A 30%, U 15%, G35%, and C 20%. A 15%, T 30%, G20%, and C 35%. A 15%, U 30%, G20%, and C 35%. A 20%, T 35%, G15%, and C 30%.
Base substitutions in a gene exon might not result in a change in the gene product because _________________________________. more than one codon may specify the same amino acid mutations in exons do not affect the final protein sequence of amino acids single base substitutions cannot alter the amino acid sequence of a protein exon most of the DNA is non-coding they are reversed during intron-splicing
The function of a gene is dictates the primary structure of a protein dictates the nucleotide sequence and chain length of a protein dictates the amino acid sequence and chain length of a protein carries genetic information DNA and RNA are similar because they are both consist of the bases A, T, G.C composed of nucleotides are involved in protein synthesis are located only in the cell's nucleus double-stranded