The human genome has 3.3 billion bases, of which 3% codes for protein. If a codon were four letters instead of three, what percentage of the genome would have to code to generate the amount of protein?

The human genome has 3.3 billion bases, of which 3% codes for protein. If a codon were four letters instead of three, what percentage of the genome would have to code to generate the amount of protein?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 10QP: What percentage of the DNA in the genome actually corresponds to genes? How much is actually...

See similar textbooks

Related questions

Q: how many codons would exist in a genetic code that was four bases long (instead of three)

A: DNA consists of four different bases, and the codon is four bases long. So, there will. be 44 number…

Q: What amino acid sequence is encoded by the codon sequence ACGCAGCGCCCGGUC? Use the 3 letter…

A: The amino acids are produced by the help of ribosome in the process of translation. In this process…

Q: While studying the structure of a small gene that was recently sequenced during the Human Genome…

A: The rule in the case of DNA indicating that there is always equality in quantity between the bases A…

Q: If you know the sequence of amino acids in a protein, what does the genetic code table allow you to…

A: Amino acids are the building blocks of proteins. Proteins serve as structural support inside the…

Q: If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is…

Q: How many codons are possible for an RNA trinucleotide having an adenine base, a cytosine base, and…

A: Genetic code is a triplet codon that was present on deoxynucleotide [DNA] or ribonucleotide [RNA]…

Q: If the sequence of a gene is: 3'TACATACCAACTGAGGATCGC5' 5'ATGTATGGTTGACTCCTAGCG3' And the RNA…

A: DNA is a double stranded helical structure found generally in Eukaryotes and prokaryotes while in…

Q: A small section of a gene for a protein has the following nucleotide sequence: CCT AAG GAT TCA CTT…

A: Introduction A mutation is a change in the DNA sequence that may occur due to incorrect…

Q: For the following DNA sequence TAC-CCC-AAA-TTT-ATC Write: the mRNA codons the tRNA anticodons…

Q: Which of the following is a true statement concerning codons A codon Will be read by RNA…

Q: If the genetic code were overlapping, how many complete codons would the followingsequence encode…

A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…

Q: Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about…

A: Introduction: 20 amino acids make up all the proteins. These are the building blocks of proteins…

Q: Does a sequence contain a gene?

A: DNA stands for doexyribonucleic acid which is made up of phosphate group, sugar group and…

Q: What would be the effect of an insertion or deletion of one of the bases in a codon?

A: Mutation may be defined as change in single or multiple base pairs resulting in altered phenotype.…

Q: Why must a polypeptide sequence begin with a designated Start codon?

A: There is an intimate connection between genes and synthesis of polypeptides or enzymes. Genes are…

Q: How many nucleotides would be needed (minimum number) to code for a protein that was 600 amino acids…

A: An amino acid is a monomer of proteins . A Nucleotide is a monomer of nucleic acid. Amino acid has…

Q: If a bacterial protein is 3,300 amino acids long, how many nucleotidepairs long is the gene sequence…

A: Introduction Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: Which of the following best describes a stop codon?

A: Stop Codons constitute of three nucleotide sequence of m-RNA that doesn't code for any amino acid.…

Q: How many bases make up a codon?

A: The flow of genetic information from DNA to mRNA to proteins is central dogma where the process of…

Q: If the DNA template strand was TACCTAGAT, what would the mRNA codons be?

A: This process is called transcription i.e synthesis of m RNA from DNA. The DNA strand that forms m…

Q: Which of the following codons is called the start codon?

A: AUG is the Start codon, which codes for Methionine.

Q: The first amino acid in a purified bacterial protein is methionine. The start codon in the mRNA is…

A: The process of protein(amino acid) formation is called translation and it is the last step of the…

Q: If you are given four nucleotides, how many possible combinations of five letter codons will you…

A: Genetic code Genetic code was discovered by Nirenberg and Mathaei in 1961 , which may be defined as…

Q: The genetic code uses three bases to encode one amino acid. Why can't the code use only two bases to…

A: Genetic code is a triplet code that consist a set of three nucleotide bases, known as codons. Each…

Q: Here is our DNA sequence: T-A-C-A-T-G-T-T-T-A-G-G-T-C-C-A-C-C-C-G-T-G-G-G-A-C-T Write the RNA…

A: Introduction The process by which the genome's DNA is copied in cells is known as DNA replication.…

Q: If the anticodon of a molecule of tRNA has the sequence GAU, what was the original DNA sequence?

A: Question - If the anticodon of a molecule of tRNA has the sequence GAU, what was the original DNA…

Q: The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start…

A: The nucleic acids DNA and RNA are found in all living things. The deoxyribose nucleic acid is DNA,…

Q: Does a single base-pair substitution in a strand of DNA always result in a new amino acid in the…

A: Transcription is processed to convert DNA into RNA. It is part of the central dogma. It is processed…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Central dogma refers to the process by which information stored in a DNA molecule is converted into…

Q: A group of 3 nucleotides codes for one amino acid. How many codons are needed to make the…

A: Translation: The process through which RNA codes for specific proteins is known as translation. It…

Q: Why could a codon not consist of only two bases?

A: The genetic information of DNA is based on the nucleotide base sequences. These sequences are…

Q: If one codon codes for two nucleotide than how many possible codons are there?

A: To find: How many codons are possible if one codon codes for two nucleotides

Q: What is meant by the statement “The genetic code is universal”? What is the significance of this…

A: DNA is deoxyribonucleic acid that contains genetic information. Gene is a segment of DNA that can…

Q: If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to…

A: During the process of transcription, the template strand or non-coding strand of DNA molecule gives…

Q: A nontemplate strand of bacterial DNA has the following base sequence. What amino acid sequence will…

A: During transcription process, the strand used as template is known as template strand which sets in…

Q: Which of the following codons is called the start codon? a.UAA b.UGA c.UAG d.AUG

A: The connection between the series of nucleotide on mRNA and series of amino acid in the polypeptide…

Q: Write the base sequence that would be sticky with the sequence T-A-T-G-A-C-T.

A: Erwin Chargaff discovered the complementary base pair rule. according to the chargeoff base-pairing…

Q: The “start” codon is ____ - ____ - ______

Q: How many nucleotides in a row make one codon?

A: A codon is a sequence of DNA or RNA nucleotides that corresponds with a specific amino acid.

Q: A triplet code with three nucleotides per codon is the most efficient way to encode the 20 different…

A: Nucleotides are the building block of nucleic acid whereas amino acids are the building blocks of…

Q: What kind of bond is created between successive amino acids in a protein? If there are more codon…

A: Proteins are made up of chemical 'building blocks' called amino acids. Nucleotide is the basic…

Q: If instead of 20 amino acids there were 200 amino acids, then how many nucleotides would you be…

A: An mRNA directs the insertion of single amino acid to a protein per three nucleotides. A codon is a…

Q: If a fragment of nucleic acid has a nucleotide sequence TAC can one assert that it is a codon or an…

A: Nucleic acids are complex bio-polymers present in most organisms. They are composed of nucleotides,…

Q: If proteins were composed of only 12 different kinds of aminoacids, what would be the smallest…

A: A codon is a sequence of 3 DNA/RNA nucleotides that corresponds to a specific amino acid during…

Q: Which of the following is an example of the degeneracy of the genetic code An amino acid can have…

A: There are total 64 combinations of base pairs that is needed to code 20 main amino acids so more…

Q: a. There are three nucleotides in each codon, and eachof these nucleotides can have one of four…

A: The genetic code is a system of principles that live cells employ to convert data contained in…

Q: How many codons are needed to specify one amino acid?

A: We know Codon are triplet of nucleotide.

Q: The genetic code is a complete, unabridged dictionaryequating the four-letter language of the…

A: Genetic code is the set of rules, encoded in genes for translation of proteins in living cells. The…

Q: If you are given four nucleotides, how many possible combinations of five letter codons will you…

A: Genetic code refers to the instructions contained in the gene that tells a cell how to make a…

Q: What are the key properties of the genetic code? Given that the genomes of all organisms are made up…

A: Genetic code is the sequence of nucleotides in DNA or RNA which determines the sequence of amino…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

100%

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps with 6 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

How many nucleotides does the human genome contain?
An RNA molecule has the following percentages of bases: A = 27%, U = 38%, C=20%, G = 15%. (A) Is this RNA molecule single-stranded or double stranded? How can you tell? (B) What would be the percentage of each of the bases in the template strand of the DNA that contains the gene for this RNA?
The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?
Which of the following is an example of the degeneracy of the genetic code?Group of answer choices a) each codon specifies more than one amino acid b) the genetic code is not degenerate c) an amino acid can have more than one codon d) None of the above
Look at Table 26.3 and find codons for the following amino acids:(a) Val (b) Arg (c) Ser
If a bacterial protein is 3,300 amino acids long, how many nucleotidepairs long is the gene sequence that codes for it?
Which of the following is a reason why codons are NOT composed of only two nucleotides?Question 22 options: A) It happened by random chance. B) The ribosome is composed of more than 2 subunits. C) The size of tRNAs requires that more than two nucleotides be present in a codon. D) There are 20 amino acids that need to be coded for.
DNA molecules consist of chemically linked sequences of the bases adenine, guanine, cytosine, and thymine, denoted A, G, C, and T. A sequence of three basesiscalleda codon. A base may appear more than once in a codon. a) How many different codons are there? b) The bases A and G are purines, while C and T are pyrimidines. How many codons are there whose first and third bases are purines and whose second base is a pyrimidine? c) How many codons consist of three different bases?
The genetic code uses three bases to encode one amino acid. Why can't the code use only two bases to encode each amino acid?
If there are 64 codons, how can there be fewer than 64 tRNA molecules?
The E. coli DNA molecule contains 4.70 x 105 base pairs. Determine the number of codons that can be present in this DNA molecule. number of codons: 1.57 x106 codons Assuming that the average protein in E. coli consists of a chain of 420 amino acids, calculate the maximum number of proteins that can be coded by an E. coli DNA molecule. number of proteins: proteins
A compact disc (CD) stores about 4.8 × 109 bits of information in a 96 cm2 area. This information is stored as a binary code—that is, every bit is either a 0 or a 1. how many bits would it take to specify each nucleotide pair in a DNA sequence? how many CDs would it take to store the information contained in the human genome?