All of the following are parts of the honeybee's processing of honey EXCEPT: producing a small amount of gluconic acid. concentrating the sugars to a supersaturated state. conversion of some glucose and fructose into sucrose. conversion of most of the fructose to the β-D-fructopyranose form.
Q: efer to the figure below. Replacing lysine with another amino acid in the protein may alter the shap...
A: Proteins: Proteins are an important class of biological macromolecules that are polymers of amino a...
Q: Complete the following diagram, using arrows to show the flow of electrons, for this reaction cataly...
A: Glyceraldehyde 3-phosphate dehydrogenase is an enzyme that catalyzes the sixth step of glycolysis an...
Q: Select the answer below that best describes the quaternary structure for the enzyme mitochondrial ci...
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. Citrate sy...
Q: What would be main consideration in the media composition forgrowth-linked products vs products Nhic...
A: The synthesis of growth-linked products (which include primary metabolites) is directly correlated t...
Q: Our talented team of bakery mixologists have designed the perfect formula for making our award winni...
A: Part 1 The average rate of reaction is calculated by dividing the change in concentration of the rea...
Q: hy is the last asymmetric carbon used to establish D/L configuration? Is this an arbitrary choice or...
A: A carbon atom has four different groups that are bonded to it which is known as a chiral carbon atom...
Q: 1.provide a solution using a table, listing all the specific individual reactions that will generate...
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic pro...
Q: A protein is allosterically regulated by a molecule. This molecule enhances the binding affinity, an...
A: Regulation in science refers to the adapted form or change in structure or function of any molecule ...
Q: Describe the key contributors to and consequences of viral genome evolution, and state why RNA virus...
A: Genome is a set of information of genetic material for any organism. Usually the genome is stored a...
Q: QUESTION 8 Imagine that a proline is present at position 4 in an alpha helical structure, the number...
A: Proline : Has secondary amino group(NH) involved in 5 membered ring structure and 2 bonds formed in ...
Q: Lipoteichoic acid
A: Lipopolysaccharides : lipopolysaccharide (LPS) are the major component found in the outer membrane o...
Q: QUESTION 30 Below is a standard curve generated by taking absorbances of standard solutions at conce...
A: Proteins are the biomolecules which are composed of amino acids. The concentration of proteins can b...
Q: Thioesters play important roles in glycolysis and tca cycle. List which reactions involve thioesters...
A: Thioesters are involved in a wide range of reactions. Attack on the carbonyl carbon to produce a tet...
Q: Why is there a need to filter the alkaline solution after adding the Barium chloride solution?
A: In an aqueous solution, barium chloride acts as a simple salt. However when dissolved in water, it ...
Q: The image below was the basis of Watson and Crick to be able to elucidate the DNA structure. Explain...
A: DNA is the genetic material which is present inside the cell nucleus of most eukaryotic cells. DNA a...
Q: Give the identity of the monosaccharide components of the tetrasaccharide: А: B: C: D:
A:
Q: You are about to isolate a 3000 bp large plasmid from an E.coli culture. You know that the plasmid i...
A: Multiple questions asked. I will answer the first question as per guidelines. Please repost the othe...
Q: The pOH of a solution of NaOH is 11.30. What is the [H+] for this solution? O 2.0 x 10-3 O 2.5 x 10-...
A: pH is the measure of the concentration of hydrogen ions in a given solution. It is measured on a log...
Q: Calculate glucose concentration. Na (sodium) and glucose secondary active transport. Na transport (w...
A: Gibbs free energy: The change in free energy for a process equals the maximum work that can be done ...
Q: 6. Frutose - 2,6-Biphasphate is made by an enzyme which itself IS regulated by phaspnorylation/depha...
A: Glycolysis is the process of metabolism of Glucose.
Q: polecules used during process, purpose Fermentation & or Occurs when? cules produced during
A: The question is all about the fermentation cycle and glycolysis cycle. Both cycle contain some gases...
Q: The pKa of the side chain of Histidine is 6.0. What is the ratio of uncharged to charged side chains...
A: Amino acids, which are made up of carbon, nitrogen, oxygen, and hydrogen, as well as the side chain ...
Q: Examples (at least 5) of house items that have nucleic acids
A: The nucleic acid was discovered by Friedrich Miescher from the nuclei of the pus cells. He called it...
Q: 7. You want to separate these four proteins in a mixture: Isoelectric point Mol. Weight (kDa) Protei...
A: A Physical method for the separation of compounds is called chromatography. In two different...
Q: CH3CSCOA -02CCH2CSCOA O=
A: The reaction shown the carboxylation of acetyl-CoA to produce malonyl-CoA. This is a thermodynamical...
Q: Give an estimate of the fragment sizes (basepairs) of the DNA bands from each sample lane of the gel...
A: In gel electrophoresis, molecules are separated depending on their size. The particles with larger s...
Q: Which of the phi/psi angles would be violating a ramachandran plot? Select all that apply: Phi= 90;...
A: The Ramachandran plot is a plot of the torsional angles - phi (φ)and psi (ψ) - of the residues (amin...
Q: In the following diagram of a portion of a protein, label the types of interactions that are shown. ...
A: Proteins are the polymers of L-amino acids. The structure of proteins is divided into four levels of...
Q: When the glycerol-phosphate shuttle is used, the production of this many ATP molecules resulting fro...
A: For completing the aerobic glycolysis, the NADH formed during the conversion of glucose to pyruvate ...
Q: Glyceraldehyde is the only three-carbon aldotetrose, and it can exist as two stereoisomers. What is ...
A: We'll answer the first question since the exact one wasn't specified. Please submit a new question s...
Q: given a stock solution of 10% dextrose, how would you make 5 mL of a 0.9% dextrose solution? find mL...
A: Given Values: The concentration of the stock solution of dextrose = 10% Concentration of the final s...
Q: Draw (be specific on the structures of each component in the cycle) and explain the entire process o...
A: Citric acid acid cycle , also called as Tricarboxylic acid cycle (TCA cycle) as the first stable int...
Q: What are the glycosidic linkages in this structure
A: A glycosidic bond, also known as a glycosidic linkage, is a form of covalent binding that connects t...
Q: Non-essential amino acids can be used to make essential amino acids through transamination. True ...
A: The amino acids that can not be synthesized in the body are called essential amino acids or indispen...
Q: Given the statements identify which are correct or incorrect
A: Multiple subparts asked. I will answer the first 3 subparts; following guidelines. Ketose - Monosacc...
Q: Competitive and non-competitive inhibitions
A: Enzyme inhibition takes place when an inhibitor binds to the substrate and inhibit the activity of e...
Q: Which of the following types of bonds are responsible for the secondary structures of proteins? Cova...
A: Almost every function in living organisms depends on proteins. These are the biomolecules composed o...
Q: When the body is deprived of food, which enzyme hydrolyzes triglycerides so that their parts enter g...
A: Biological macromolecules are those large molecules that are necessary for the survival and growth o...
Q: Why are nucleobases in nucleic acids called "bases"? 1. Because they resemble baseball bases ...
A: Nucleobases : Purine(A,G), pyrimidine(T,C) Purines hydrogen bonds with pyrimidines A double bond T G...
Q: Draw the Haworth structure of the tetrasaccharide:
A:
Q: Antimicrobial Resistance (AMR) 2. Explain Antimicrobial stewardship (AMS
A: The question is all about the Microbes that antimicrobial resistant i.e AMR, so some bacteria, virus...
Q: Why do steroid hormones not require signal transduction and second messengers to exert their actions...
A: Steroid hormones:- It is a group of hormones , belong to the class of chemical compounds known as st...
Q: 1. In a serial dilution, one initially sets a starting dilution and adds an aliquot portion of it su...
A: Serial Dilution is a important procedure to obtain the desired concentration of reagent or serum or ...
Q: "Although PTC is not found in nature, the ability to taste it correlates strongly with the ability t...
A: This is a hereditary feature, according to PTC, and non-taster status has been connected to a number...
Q: 45. Why are topoisomerase inhibitors excellent drugs? How is it possible to use agents that block th...
A: Topoisomerases are nuclear enzymes which participate in DNA supercoiling (overwinding or unwinding)....
Q: How to take paracetamol for fever?
A: Paracetamol is medicine taken to reduce pain and decrease the body temperature during fever.
Q: serotonin [µM] 0.025 transport rate A [dpm/min] 300.0 transport rate B [dpm/min] 10 0.08 920.0 2500....
A: The transport of serotonin is mediated by the serotonin transporter or SERT protein terminates the a...
Q: Explain the importance of the protein structures (from its primary to quaternary structures) in thei...
A: Proteins are the polymers of L- alpha-amino acids. They have four different levels of structural org...
Q: Give one physiological c
A: pH is the measure of the strength of H+ ion or Hydronium ions in solution. pOH is the ...
Q: This is DNA. Locate the nitrogen bases (nitrogens are blue). Where are they located in the molecule?...
A: DNA is a nucleic acid that is made up of nitrogen bases, sugar and phosphate groups linked together....
All of the following are parts of the honeybee's processing of honey EXCEPT:
producing a small amount of gluconic acid. |
||
concentrating the sugars to a supersaturated state. |
||
conversion of some glucose and fructose into sucrose. |
||
conversion of most of the fructose to the β-D-fructopyranose form. |
Step by step
Solved in 4 steps
- The carboxylase activity of RuBisCO catalyzes the fixation of carbon dioxide. Group of answer choices: True FalseWhat products are formed when the stachyose (refer to the photo) is hydrolyzed? sorbose, 2 molecules of tagatose and 2 molecules of fucose glucose, fructose, and 2 molecules of galactose glucose, fructose, and galactose glucose, 2 molecules of fructose and 2 molecules of galactoseWhich sugar is better to use as substitute for table sugar for diabetics, L-arabinose or maltose? Explain why.
- Honey formation depends on invertase activity to convert sucrose from flower nectar into simple monosaccharides. Explain why this contributes to the different sweetness level between the two honeys.Which of the following will tetrahydrofolate not carry? -C=NH -CH2- -CO2 -CH3 =CH- O-C=OLactose is found in milk products. It is converted by the body into a usable form in a series of chemical reactions. The diagram shows the series of reactions that convert lactose into a usable form. Enzyme 1 Enzyme 2 Enzyme 3 Enzyme 4 galactose- 1-phosphate Lactose galactose glucose- 1-phosphate glucose- 6-phosphate If enzyme 2 is denatured (destroyed), the levels of which substance will increase?
- Why is egg buoyancy an indicator of egg freshness? Explain in terms of the chemical/biochemical reactions that occur during storage.With respect to the following pairs of biomolecules which is produced via a mutarotation? D-Fructose and L-Fructose a-D-Fructose and 3-L-Glucose a-D-Mannose and 3-D-Mannose O a-D-Fructose and 3-L-Fructose O D-Fructose and D-Glucosegive a detailed overview of how tryglycerides are metabolized under aerobic conditions. note the steps involved and the specific reactants and products of each step.
- One example of a stage 3 reaction in the heterotrophic breakdown of food molecules is: the intramitochondrial digestion of fatty acids into carbon dioxide and water the intracellular digestion of glucose monomers into pyruvate the intracellular digestion of some amino acids into NH4+ and pyruvate the extracellular digestion of polypeptides into amino acids the extracellular digestion of triglycerides into fatty acids and glycerolOne example of a stage 1 reaction in the heterotrophic breakdown of food molecules is: the intramitochondrial digestion of pyruvate into carbon dioxide and water the intramitochondrial digestion of fatty acids into carbon dioxide and water the extracellular digestion of triglycerides into fatty acids and glycerol the intracellular digestion of some amino acids into NH4+ and pyruvate the intracellular digestion of glucose monomers into pyruvateWhenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?