The image below was the basis of Watson and Crick to be able to elucidate the DNA structure. Explain/Discuss the meaning of this image as seen by Watson and Crick and how was it able to support the present-day structure of the Watson and Crick DNA?
Q: If a protein were placed in a nonpolar solvent, would it have the same structure as the same protein...
A: Proteins play out an incredible assortment of particular and fundamental functions in the living cel...
Q: Compound A below is a key intermediate in the synthesis of keto-myo-inositol B. Suggest a synthetic ...
A: Here compound C is D-Glucose D-Glucose is converted into Glucose-6-Phosphate in presence of Hexokina...
Q: 9. For the following aspartate reaction in the presence of inhibitor, Km = 0.00065 M. Determine Vmax...
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation energy....
Q: Which
A: Presence of amino acids and its proximity affects pka value of other
Q: 6. The popular these days energy drinks have caffeine, theophylline, and carnitine among other compo...
A: Beverages that contain ingredients marketed to increase energy & mental alertness are called ene...
Q: You perform a Bradford assay. You obtain the absorbance values listed below from the BSA samples; yo...
A: Protein quantitation is very important process before processing protein samples for further experim...
Q: Prior to a marathon run, an athlete consumes large amounts of complex carbohydrates to do what is kn...
A: Carbohydrate loading is a strategy used by endurance athletes such as marathon runners to increase g...
Q: From the following protected amino acids, write the reaction equation to synthesize a tripeptide of ...
A: Merrifield solid technique describe the peptide synthesis using a solid support of hydrocarbon resin...
Q: say you have been asked to determine the molecular structure of a soluble protein with roughly 500 a...
A: Determining the structural basis of protein in a molecular or even atomic level would enable us to u...
Q: How do microorganisms affect people directly and indirectly? List and describe: 1) products produce...
A: Organisms that are of microscopic size are called microorganisms. They are also called microbes and ...
Q: 5' AU Py U A AGGCC G. UGGC G C G GGG What modified nucleoside base is indicated by the arrow? dihydr...
A: The answer of the above question is : Pseudouracil (Ψ). Pseudouridine (psi- Ψ)is an isomer of the nu...
Q: Explain why saturated (flat) fatty acids cause more plaque in blood vessels than unsaturated (gnarle...
A: In an aqueous environment the polar heads of the fatty acids will engage in favorable interaction be...
Q: Draw the biosynthetic pathway with explanations of each step for the following secondary metabolite ...
A: Polyketides are naturally found molecules of a large and diverse group of secondary metabolites whic...
Q: What are some examples of biochemical tests for proteins that involve acid hydrolysis or base hydrol...
A: Proteins: Proteins are complex high-molecular-weight molecules that consist of amino acids joined b...
Q: What name is given to the assembly of proteins that carry out DNA copying at a replication fork? tra...
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any ...
Q: Make a schematic diagram for the synthesis, storage, release, and degradation of acetylcholine.
A: Acetylcholine is main neurotransmitter of the parasympathetic nervous system.
Q: Both triglycerides and prostaglandins can contain unsaturated fat. O True O False
A: Triglycerides (triacylglycerols) are stored form of fat. Triglycerides are composed of three fatty a...
Q: What is the role of ATP in cell signaling in biochemistry?
A: ATP has key functions in cell signaling and the signal transduction process heavily relies on ATP. A...
Q: What are the three special proteins needed to form the initial replication bubble?
A: Replication is an essential process taking place in all living organisms that ensure the maintenance...
Q: Nucleic acid has significant absorption in the UV range because of the presence of the sugar-phospha...
A: Cells, the most fundamental unit of life, are found in all living things. All of life's vital activi...
Q: What is the chemical nature of the chromophores of each of the three materials separated on CM-Sepha...
A: Chromatography is a physical method for the separation of compounds. Two immiscible phases ...
Q: Which type/s of histones is/are not part of the histone octamer wrapped by DNA strands but is found ...
A: Histones proteins are present as octamer (eight) complex at the center of nucleosome. It consist of ...
Q: Consider a mixture of two proteins with molecular weights of 20,000 and 200,000. For simplicity of c...
A: Sedimentation Coefficient is the rate per unit centrifugal field experienced by the particle undergo...
Q: One of the most glaring difference between red and white wines is that red wines....... Select one:...
A: White wine : synthesized with white grapes, and the skin gets separated from juice prior to the ferm...
Q: what type of reaction is the the reverse synthesis of ceramides from sphingosine
A: Ceramides belong to the family of waxy lipids that contain sphingosine and fatty acids. It is abunda...
Q: You have 10 mg/ml ethidium bromide solution. If you add 5 µl of this to 50 ml of agarose gel solutio...
A: Gel electrophoresis is a laboratory method for separating DNA molecules depending on their size and ...
Q: 1. List as many as possible blood bank serologic tests that are affected by hemolyzed samples (list ...
A: Hemolysis: It is the breakdown of red blood cells and there are a few reasons why blood can be hemo...
Q: An antibody (Ab) can bìnd to its antigen binding site (B) with a high affinity (large negative AG°)....
A: The antibodies bind to its antigen via non n covalent interactions like hydrogen bonding, hydrophobi...
Q: How to use the sterile filter? Show the different sizes and specifications of sterile filters.
A: Sterilization is the method that is used to eliminate all forms of life and biological agents presen...
Q: HC CH reaction with HC CH lysosome .CH CH HC CH3 HC CH3 H2 HC C CH HC CH CH3 CH3 OH OH inside the ce...
A: In the lysosome, most of the glycoconjugates are degraded and monosaccharides generated by ...
Q: Read through each scenario. Under the scenario, write which lab safety rule is being broken and indi...
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first 3...
Q: 26. Dietary triglycerides are hydrolyzed by pancreatic lipase, which is related to but distinct from...
A: The pancreas is a heterocrine gland because it secretes digestive juices and hormones. Pancreatic am...
Q: A geneticist discovers that two different proteins are encoded by the same gene. One protein has 56 ...
A: Organically active proteins are the polymers of L-amino acids linked by a peptide bonds. Various ada...
Q: Name some techniques/approaches (name, describe the major steps, how to analyze/interpret results) ...
A: Proteins: Proteins are polymers that contain hundreds or even thousands of amino acids that are lin...
Q: What name is given to the assembly of proteins that carry out DNA copying at a replication fork? O c...
A: Every time cells divide, eukaryotic genomes are duplicated with near-perfect fidelity. The circumsta...
Q: Methotrexate used in chemotherapy? How does it work in terms of enzyme inhibition that is involved i...
A: Methotrexate- is a an anti-cancer chemotherapy drug. It is one of a group of chemotherapy drugs call...
Q: It is estimated that the most common amino acid in a protein is leucine. What is the relative leucin...
A: Leucine is an aliphatic hydrophobic amino acid residue. These residues populate the interior hydroph...
Q: 1. Explain the biochemical role of the phosphate that is removed in reaction B. 2. What would be a ...
A: "Since you have asked multiple questions, we will solve the first three questions for you. If you wa...
Q: In full details. Explain the significance of redox potentials formed by redox pairs in the electron ...
A: Redox Reaction: This is a type of reaction which is a combination of both oxidation and reduction re...
Q: The industrial process for forming methanol involves a eatalyst Catalyst CO + 2H2 High p.T CH;OH Dra...
A: Methanol production on an industrial scale requires technologies that employ Cu-based catalysts. The...
Q: People suffering with sickle cell anemia have a structural defect in hemoglobin (HB). The major reas...
A: Hemoglobin is the iron-containing pigment in the red blood cells which helps the blood to carry or t...
Q: Aside from physical characteristics, give some other production parameters that are needed in the se...
A: Culling chickens is the process of identifying and removing non-laying or low-producing hens from a ...
Q: Describe and give the results of an experiment that shows that polymerase I is located primarily in ...
A: The eukaryotes have three RNA Polymerases These RNA Polymerase I , II and III, have different locali...
Q: 15. Which of the following statements refer to glycolysis? 1- carbon dioxide is released Il - it occ...
A: During glycolysis glucose is broken down by a series of steps to form pyruvate. Under aerobic condit...
Q: Describe how the following properties affect the function of a protien: A.) R group orientation B.) ...
A: Amino acids are biomolecules that are comprised of two functional groups, these are an amino group (...
Q: Ceramide is synthesized biologically from sphingosine. 1. What type of reaction in this synthesis re...
A: Ceramide is a type of lipid, which is composed of sphingosine and fatty acids. Ceramide forms glycol...
Q: Describe the role of glutamine and glutamate in amino acid metabolism.
A: Glutamine: It is a non-essential amino acid as it is produced by our body. It is the primary amino ...
Q: Why is biochemistry called the chemistry of life?
A: The question is all about the subject biochemistry that it is called as chemistry of life as our hum...
Q: What class of enzymes catalyze the phosphorylation of amino acid residues in proteins? a. kinase...
A: Kinases are enzymes that adds a phosphate group to molecules such as sugars or proteins. Phosphatase...
Q: In Eukaryotes, some hydrogen bonds are formed in between amino acids of the histones and phosphodies...
A: DNA and RNA are made up of long chains of nucleotides and ribonucleotides bases. Sugar molecule...
The image below was the basis of Watson and Crick to be able to elucidate the DNA structure. Explain/Discuss the meaning of this image as seen by Watson and Crick and how was it able to support the present-day structure of the Watson and Crick DNA?
Step by step
Solved in 4 steps with 1 images
- What background information did Watson and Crick had available with them for developing a model of DNA? What was their own contribution?Discuss the contributions of Chargaff, Franklin/Wilkins, and Watson/Crick in the elucidation of the structure of DNA. What was the “take home” from each?X-ray was used by Rosalind Franklin and Maurice Wilkins to study the molecular structure of DNA. Why is their finding not accepted by Watson and Crick? Explain.
- Describe the various characteristics of the Watson–Crick doublehelix model for DNA.At that time, why did it seem reasonable for the bases to be on the outside of the DNA molecule and what evidence caused Watson and crick to revise this model?Southern blotting is a method used in molecular biology for detection of a specific DNA sequence in DNA samples while northern blotting is used for the detection of RNA in a sample. Write down the similarities and differences between both methods.
- A student is running gels to sequence a DNA fragment as below. In addition to running four sequencing reactions with the requisite ddNTPs, they also include four ‘mystery’ reactions representing variants of the first sequencing lane (using ddATP to sequence T in the template) in which one or more components of the reaction have been omitted or inappropriately added. Give a possible explanation for the what was inappropriately added/omitted in each mystery lane. Note two important things: firstly, even if everything works perfectly there is still always some unextended primer in a reaction. Secondly, there may be more than one possible explanation for some lanes; just give one.Examine the sequence for the DNA fragment below. Your job is to design primers for PCR that would be able to amplify this entire DNA fragment. Your answer must fulfill the following criteria: Design the primers so that they are each 7 bases in length. Please write out the sequence of these primers. Don’t forget to indicate the direction (polarity) of both ends of each primer. Note that only the polarity of one end of one of the template strands of DNA is provided below. Describe where the primer would bind (i.e. top or bottom template strand, left or right side of the DNA strand) Organize your response so that each primer, and associated information, is separated by at least one blank lineExamine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TTGCATCG 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA, and will this primer work as part of a pair to successfully amplify this fragment of DNA? 5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA 3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT a. It will bind to the bottom strand on the left side of the fragment, and is suitable to amplify the fragment by PCR. b. It will bind to the top strand on the left side of the fragment, but it is unsuitable to amplify the fragment by PCR. c. It will bind to the top strand on the right side of the fragment, but it is unsuitable to amplify the fragment by PCR. d. It will bind to the bottom strand on the right side of the…