The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary DNA strand
Q: G C T A T A A T G G C A a a a t t g G G T C A G G C A a a t c g a C A T A G C T G A C G G g g a t g…
A: Dna is read in 5 ' to 3 ' direction and the mrna is read by the trna in the form of genetic code by…
Q: The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would be produced…
A: Introduction Genes contains specific nucleotide sequences which can be transcribed into the mRNA by…
Q: hat describes or designates the 3' end of a DNA strand? a. an available hydroxyl group on the…
A: DNA is a double stranded helical structure.It is made up of nucleotides. Each nucleotide is composed…
Q: The template strand of a double helical segment of DNA consists of the following sequence:…
A: Introduction: DNA is a type of nucleic acid that is present in the nucleus of the cell. It is a…
Q: Give the corresponding strand of the DNA having the sequence of: a. 5’…
A: DNA(deoxyribonucleic acid) is the heredity material for most living organisms. It is composed of…
Q: A small section of bacterial DNA antisense strand has the following nucleotide sequence: GCC CAC…
A: An Antisense DNA strand directed in 5’ to 3’ end is the non-coding DNA strand of a cell which acts…
Q: A DNA strand has the following sequence: 5’-GAACCCGATGGCGATACATTTACCAGATCACCAGC-3’ In which…
A: The deoxyribonucleic acid (DNA) replication involves the multiplication of DNA strands. The DNA is a…
Q: The following are DNA fragments containing a small gene. The top strand is the coding strand.…
A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…
Q: What is the sequence of the DNA template strand from which each of the following mRNA strands was…
A: As we know that the DNA carries the information, which is translated into the mRNA and transcribed…
Q: What is the consensus sequence of the following six DNA…
A: DNA or the Deoxyribonucleic acid present in both eukaryotes and prokaryotes are made up of millions…
Q: Choose the correct protein sequence that would result from the following DNA template sequence using…
A: Central dogma is the central cellular process that helps in the conversion of the DNA to m RNA by…
Q: If you have got the following DNA template molecules, which one of them will require more energy to…
A: The DNA is composed of purines and pyrimidines. The purines in DNA are adenine and guanine. The…
Q: Here is a nucleotide sequence: ATGCAAGGTT. Choose the answer that correctly identifies both the type…
A: DNA and RNA are two nucleic acid polymers found in all living cells. Both are made up of nucleotide…
Q: If you have got the following DNA template molecules, which one of them will require more energy to…
A: Melting temperature is the temperature at which a double-stranded molecule of DNA is broken down…
Q: One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the…
A: The central dogma of molecular biology is the metabolic process in which the double-helical…
Q: Reading from left to right, what is the nucleotide sequence on the other strand of DNA in this…
A: Answer :- D) G-G-C-A-T-A-T-G-T-A Double-stranded DNA takes the form of a helix, sort of a ladder…
Q: A portion of one strand of DNA has the sequence 5′ AATGGCTTA 3′. If this strand is used as a…
A:
Q: One half of a DNA strand has the following sequence of bases GCTACGGCGTTATCCCC. What would appear on…
A: In a DNA molecule each deoxyribonucleotide is made up of a sugar, nitrogenous base and phosphoric…
Q: If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following…
A: DNA universally has 4 N-bases: Adenine, Thymine, Guanine and Cytosine If the given strand sequence…
Q: 5.1) Do you expect DNA strands 1 and 2 below to have the same melting point? Justify your answer.…
A: As per bartleby guidelines we are only allowed to answer one question. Please post the other…
Q: Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA…
A: Double stranded nucleic acids are formed through hydrogen bonding between complementary nitrogenous…
Q: A template DNA strand coded for the following sequence: CTCAAGTTATGTATGTCCGATTCGCATGCGCT 1) What is…
A: DNA is the genetic material of the cell which gets transcribed into mRNA with the help of RNA…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the…
A: Deoxyribonucleic acid (DNA) is a molecule with two chains of polynucleotides that wrap around one…
Q: A primer is laid down complementary to the DNA sequence TAGCAATCGCA to prime synthesis of a daughter…
A: Answer: Introduction: In living organisms, primers are short strands of RNA or DNA commonly 18-22…
Q: If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the…
A: The hydrolysis is targetting the 3' Carbon of the sugar in the phosphodiester bond. 1st strand…
Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written…
A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…
Q: There are base pairing rules for writing complimentary DNA strands for a given strand. A pairs with…
A: According to Bartleby guidelines, we are supposed to answer first three subparts in case of multiple…
Q: The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What MRNA would be produced…
A: The transcription process enables an enzyme known as RNA polymerase to bind to the DNA and break…
Q: Which of the following feature/s characterize B-form DNA? I. Two antiparallel, polynucleoside chains…
A: The genetic material in most living organisms is present in the form of deoxyribonucleic acids…
Q: A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA…
A: DNA probes are single-stranded DNA segments that are hybridised to indicate the existence of…
Q: The template strand of a double helical segment of DNA consists of the following sequence:…
A: DNA is first transcribed into messenger RNA and then mRNA is translated into protein sequence.
Q: What is the melting temp. of the following double-stranded DNA fragment…
A: Melting temperature formula : Tm = 4* (G+C) + 2 * (A+T) Number of G+C = 6 Number of A+T = 20
Q: For the following DNA sequence: 3-CGATACGGCTATGCCGGCATT-5' The the sequence of the complementary DNA…
A: Complimentary base pairing Base pairing take place between a purine and pyrimidine. In DNA, adenine…
Q: The following sequences of DNA would be synthesized using 5′-CAGTTCGGA-3′ as a template: *…
A: DNA is synthesized in 5' to 3' direction.
Q: The template strand of a double helical segment of DNA consists of the following sequence:…
A: Translation is the mechanism by which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: The template strand of a double helical segment of DNA consists of the following sequence: 5’-…
A: Hi! Thank you for the questions. As you have posted questions with multiple subparts, I will be…
Q: What is the melting temp. of the following double-stranded DNA fragment…
A: Melting temperature of the DNA is the temperature at which half of the DNA becomes single stranded…
Q: Which of these single strand RNA sequences could form a hairpin secondary structure? 5'…
A: The RNA is usually a single stranded molecule of nucleic acid. In RNA four types of nitrogenous…
Q: Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’…
A: Of the two strands of DNA, the template strand or non-coding strand is used for transcribing an mRNA…
Q: If the recognition sequence of the restriction enzyme Hindlll is AAGCTT, then how many covalent…
A: The enzymes that are able to cut the DNA at specific sites are known as restriction enzymes. The…
Q: Draw the complementary DNA strand for the given: 5'-A-T-C-C-G-A-A-T-T-G-3' Draw the complementary…
A: Let us first understand the one letter codes for the given nucleotides: A is Adenine T is Thymine…
Q: If you have got the following DNA templatemolecules, which one of them will require more energy to…
A: The separation of two antiparallel strands of DNA is dependent on GC content of DNA. G is guanine…
Q: The template strand of a double helical segment of DNA consists of the following sequence:…
A: DNA is composed of nucleotides and it is a double-stranded helical molecule, and each of nucleotide…
Q: Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of…
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: The following are DNA fragments containing a small gene. The top strand is the coding strand.…
A: DNA fragments – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…
Q: 5'-AAGCGGGTGTGAGGAGCGCGGCAGCTCAGGTACCCCCGGCCAGGCGCG-3' 31-TTCGCCCACACTCCTCGCGCCGT…
A:
Q: What is the nucleotide sequence of the DNA strand that is complementary to 5'-GGCGCAACTGTCACAA-3'
A: A nucleic acid sequence is a set of five letters that indicates the order of nucleotides in a DNA or…
Q: If you have got the following DNA template molecules, which one of them will require more energy to…
A: DNA is made out of four unique sorts of nucleotides, in particular, adenine, thymine, cytosine, and…
Q: The following are DNA fragments containing a small gene. The top strand is the coding strand.…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following…
A: When referring to DNA transcription, the coding strand is the DNA strand whose base sequence…
The template strand of a double helical segment of DNA consists of the following sequence:
5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’
Trending now
This is a popular solution!
Learn your way
Includes step-by-step video
Step by step
Solved in 2 steps
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.
- If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letterWrite the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA TGTGCGCGCGGGGCGThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: bottom strand is the noncoding strand). 5'-ААCGCATGAGAAAGCCCCCCGGAAGATCACСТТСCGGGGGCТТТАТАТААТТАGC-3' 3'-тTGCGTACтстттCGGGGGGCCTTCTAGTGGAAGGCCCCCGАААТАТАТТААТтCG-5' (i) Draw the structure of hairpin loop that will be formed during transcription. (ii) Illustrate how the hairpin loop structure initiates the termination of transcription.
- A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: G G C T A G C T G C T T C C T T G G G G A C C G A T C G A C G A A G G A A C C C C T Template strand with its polarity: 3’ C C G A T C G A C G A A G G A A C C C C T 5’ - Coding strand with its polarity: 3’ G G C T A G C T G C T T C C T T G G G G A 5’ Please write out the mRNA sequence generated by the template strand to produce that polypeptide chain.Write the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACATFor the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strand
- Convert the following DNA sequences to RNA sequences.Sequence # 1: CCGGTTCAGGCTTCACCACAGTGTGGAACGCGGTCGTCTCCGGCGACCSequence # 2:CTAAGGTTGCTAATCTCAGCGCTCCGCTGACCCCTCAGCAAAGGGCTTGSequence # 3:GCTCAATCTCGTCCAGCCATTGACCATCGTCGAGGGGTTTGCTCTGTTACSequence # 4:CAAAACGAAATCGAGCGCCATCTGCGGGCCCCGATTACGGACATCAGASequence # 5: TCCAACTCGGGGTCCGCATCGCTCCGCCGGCGACCGACGAAGTTCCGAThe template strand of a double helical segment of DNA consists of the following sequence: 5'- АТАСССТСАССTGGCAATAАСTGTTCGGAТСАСGAGGGGCCAAACССТСТТТА ССАТАТАGAGCTG-3' NOTE: Use the given data to answer the succeeding questions and always indicate (and pay attention to) the DIRECTIONALITY of the strands in your answers.In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where certain base pairs are exposed is called the: