A virus has a double-stranded RNA genome that has 2400 base-pairs. Of these, 35 % are G:C base-pairs. How many uracil nucleotides would be present in this virus?

Q: The BamH1 enzyme comes at a concentration of 100,000 U/ml. You are asked to digest 20 ug of DNA with…

A: The term "specific activity" describes the amount of an enzyme's enzymatic activity that is produced…

Q: Search the protein data bank (https://www.rcsb.org/)and find an image of one protein that is found…

A: The SARS-CoV-2 virus is the infectious disease known as coronavirus disease (COVID-19). A group of…

Q: nucleoside is composed of a) a base+ a sugar b) a base+ a sugar+ phosphate c) a base+ a phosphate…

A: Nucleotides and nucleosides make up nucleic acids (DNA and RNA). Both nucleotides and nucleosides…

Q: If a virus particle contained double-stranded B-DNA of 400,000 base pairs, A. What would be the…

A: DNA, deoxyribonucleic acid is the hereditary material in found in humans and almost all living…

Q: What is the difference between a deoxynucleotide triphosphate (dNTP) and a dideoxynucleotide…

A: dNTPs are also called deoxyribonucleotide triphosphate. Each dNTPs are made up of a phosphate group,…

Q: Researchers have been determining the nucleotide sequences of variant forms of SARS-CoV-2, looking…

A: The question is all about the mutations that are defined as the abrupt changes in DNA sequences that…

Q: When proteins recognize and bind to a specific sequence in DNA, why do they usually just recognize…

A: DNA binding proteins are proteins that bind to single or double stranded DNA generally in the major…

Q: A) Describe each step of the DNA REPLICATION in EUKARYOTIC organisms B) Describe each step of the…

A: Transcription = Re-writing DNA into RNADNA is "transcribed" or re-written into RNA in a very…

Q: structure of its covalent adduct to DNA

A: Chlorambucil is a monocarboxylic acid that is butanoic acid replaced at the 4th position by a…

Q: A viral protein has a 20 amino acid amino acid chain consisting of the following primary structure:…

A: Amino acids are the building units of a protein. In viruses, protein is present in the capsid,…

Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…

A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…

Q: The 20 different amino acids in the protein are normally coded by ------ nucleotides. * 60 61 62 63

A: Nucleotides are building blocks of nucleic acids. Three mRNA nucleotides present together are known…

Q: The base composition of an RNA virus was analyzed and found to be 14.1% A, 14.0% U, 36.2% G, and…

A: RNA refers to Ribonucleic acid, a type of nucleic acid which was evolved earlier than the DNA in…

Q: Describe the term SDS-PAGE.

A: Charged particles migrate during electrophoresis under the influence of an electric current. For…

Q: Why are single-stranded binding (SSB) proteins required?

A: SSBs are nucleoproteins that can be found in bacteria, bacteria, and animals. When opposed to…

Q: A DNA segment has a total of 1000 nucleotides, out of which 240 of them are adenine containing…

A: Introduction: DNA (deoxyribonucleic acid) is the molecule that transmits genetic codes for an…

Q: The FDA finds that chickens across the US are infected with a new type of bird-flu. They determine…

A: Codon is a sequence of three nucleotides that together form unit of genetic code in a DNA or RNA…

Q: As stated in the text, bacteriophages have been discovered with the following base substitutions in…

A: (a) it is possible for dUMP to be completely substituting for dTMP if the viral genome is able to…

Q: You have isolated a fragment of viral DNA that supposedly encodes for two proteins, 196 and 220…

A: Expression of proteins from genes on DNA occurs in two steps - transcription and translation. During…

Q: TRUE or FALSE a) The deoxyribose connects to N9 of guanine. b) In a dsDNA, a pyrimidine in one…

A: Purines and pyrimidines are nitrogen-containing aromatic compounds. They are the major components of…

Q: The phosphate group furthest from the sugar in a nucleotide is the, phosphate Select an answer and…

A: Deoxyribonucleic acid (DNA) and Ribonucleic acid (RNA) consist of long chains of nucleotides. A…

Q: identify the type of DNA binding motif is shown and the characteristics.

A: DNA stands for deoxyribonucleic acid. A DNA-binding domain consists of a structural motif that…

Q: a variant of the SARS-CoV-2 virus has been found in brazil. this variant contains the mutation…

A: Amino acids are monomers that serve as the protein's building blocks. Amino acids share basic…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: A nontemplate strand of bacterial DNA has the following base sequence. What amino acid sequence will…

A: During transcription process, the strand used as template is known as template strand which sets in…

Q: Use the identity of the drug target to find the nucleic acid sequence of the gene that encodes the…

A: A biological target is a molecule located intrinsically in the body. Such molecules have the ability…

Q: Write a DNA sequence that would encode the amino acid sequence…

A: In DNA, the hereditary information is contained within the nucleotides called codons that correspond…

Q: What kind of repeating polynucleotide would yield a single polypeptide with a tetrapeptide repeating…

A: Polynucleotide is a sequence of nucleotides. Nucleotides consist of a sugar molecule, a phosphate…

Q: What is the sequence of amino acids coded by the following sequence of nucleotides on a strand of…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Give 3 strand slippage and trinucleotide repeat disorder examples

A: DNA is the source of genetic information. It transfers genetic information from parents to…

Q: You are studying COVID-19 which infects bat cells through an interaction between a lysine residue on…

A: Proteins are large biomolecules made up of amino acid residues linked via a peptide bond. Amino…

Q: Draw each of the following base pairs: A-T, G-C, and U-

A: Adenine, guanine, cytosine and thymine are the nitrogenous bases which are present in DNA and in RNA…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.