The FDA finds that chickens across the US are infected with a new type of bird-flu. They determine the sequence coding for the virus's surface proteins and see that some chickens'viruses have code (1) and some chickens' viruses have code (II).(1) 5' CAUGAUAUUGUACUUU 3'(II) 5' GAAUGGAACUGCAACUC 3'nalTranslate the partial sequence for type I flu protein. "Be sure to start translation at the start codon!Second letterUCGUUU PheUUC.UUAUUG FLeuUCUUCCSerUAUUAC Tyr UGCJoysUAA Stop UGA StopUAG Stop UGG Trp GUCAUCGCUUCCUCCCACCGCAUHisCACJProCAA1GIinCAGJCGU)CGCCUCLeuCUACGA ArgCGGCUGACUACCACAAUG Met ACGAAUAACJAAAAAGJAGUSerAGC.AUUAsnAUC leThrAUAAGAArgLysAGG.GUUGUCValGGUAGUGGCUGCCGCAGCGGGU)GGCGAUAspGAC.AlaGAA)GluGAGJGGA GlyGGGO Glu - Trp - Asn - Cys - AsnO Met - Glu - Leu - Gin - LeuO Met - lle - Val - Leu - GlyO Met - lle - Leu - Tyr - PheO His - Asp - lle - Val - LeuFirst letterThird letter

Codon is a sequence of three nucleotides that together form unit of genetic code in a DNA or RNA…

The FDA finds that chickens across the US are infected with a new type of bird-flu. They determine the sequence coding for the virus's surface proteins and see that some chickens' viruses have code (I) and some chickens' viruses have code (II). (1) 5' CAUGAUAUUGUACUUU 3' (1I) 5' GAAUGGAACUGCAACUC 3' Translate the partial sequence for type I flu protein. 'Be sure to start translation at the start codon! Second letter U C UUUPhe UUC UUA Leu UAULT UCU UCC Ser UCA UGU Tyr UGCCYS UAA Stop UGA Stop UAG Stop UGG Trp UAC UUG S UCG CAU CAC His CGU CGC Arg CUU CCU C СА CCG U CỤC Leu CUA Pro CAA) Gln CGA CUG CAGJ CG G ACU AUU AUC Fle AAU AACJ AGU Ser AGC. Asn ACC Thr AUA AUG Met ACG AAA AGA Arg AGG. ACA AAG FLys GCU GCC GCA GCG GAU GGU GGC Gly GUU Asp GUC Val GUA GAC Ala G GAA) GAG Glu GGA GGG GUG O Glu - Trp - Asn - Cys - Asn O Met - Glu - Leu - Gin - Leu O Met - lle - Val - Leu - Gly O Met - lle - Leu - Tyr - Phe His - Asp - lle - Val - Leu o o o o First letter Third letter

The FDA finds that chickens across the US are infected with a new type of bird-flu. They determine the sequence coding for the virus's surface proteins and see that some chickens' viruses have code (I) and some chickens' viruses have code (II). (1) 5' CAUGAUAUUGUACUUU 3' (1I) 5' GAAUGGAACUGCAACUC 3' Translate the partial sequence for type I flu protein. 'Be sure to start translation at the start codon! Second letter U C UUUPhe UUC UUA Leu UAULT UCU UCC Ser UCA UGU Tyr UGCCYS UAA Stop UGA Stop UAG Stop UGG Trp UAC UUG S UCG CAU CAC His CGU CGC Arg CUU CCU C СА CCG U CỤC Leu CUA Pro CAA) Gln CGA CUG CAGJ CG G ACU AUU AUC Fle AAU AACJ AGU Ser AGC. Asn ACC Thr AUA AUG Met ACG AAA AGA Arg AGG. ACA AAG FLys GCU GCC GCA GCG GAU GGU GGC Gly GUU Asp GUC Val GUA GAC Ala G GAA) GAG Glu GGA GGG GUG O Glu - Trp - Asn - Cys - Asn O Met - Glu - Leu - Gin - Leu O Met - lle - Val - Leu - Gly O Met - lle - Leu - Tyr - Phe His - Asp - lle - Val - Leu o o o o First letter Third letter

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 38CTQ: A scientist discovers a virus encoding a Protein X that degrades a subunit of the elF4F complex....

See similar textbooks

Similar questions

The FDA finds that chickens across the US are infected with a new type of bird-flu. They determine the sequence coding for the virus's surface proteins and see that some chickens' AG FLYS viruses have code (I) and some chickens' viruses have code (I1). (1) 5' CAUGAUAUUGUACUUU 3' (1I) 5' GAAUGGAACUGCAACUC 3' Translate the partial sequence for type I flu protein. "Be sure to start translation at the start codon! Second letter C UUU UUC J UUA UUG J UCU UCC Ser UAU Tyr UACJ UAA Stop UGA Stop UAG Stop UGG Trp G Phe UGU UGC Cys UCA Leu UCG CUU CAU CGU CGC CCU C ССА CCG CUC CUA CAC His Leu Pro CAA GIn CAGJ CGA FArg CGG CUG AAU Asn AAC S ACU ACC ACA AUG Met ACG AUU AGU Ser AGA Arg AGGJ AUC lle A AUA Thr GUU GCU GAU GGU GAC Asp GUC GCC GGC G Val Ala GAA Gly GCA GCG GGA GUA GUG GAGJ Glu GGG O Glu - Trp - Asn - Cys - Asn O Met - Glu - Leu - Gin - Leu O Met - lle - Val - Leu - Gly O Met - lle - Leu - Tyr - Phe O His - Asp - lle - Val - Leu First letter Third letter
The FDA finds that chickens across the US are infected with a new type of bird-flu. They determine the sequence coding for the virus's surface proteins and see that some chickens' viruses have code (I) and some chickens' viruses have code (II). (I) 5' CAUGAUAUUGUACUUU 3' (II) 5' GAAUGGAACUGCAACUC 3' What type of nucleic acid does this virus have? O DNA O RNA O RNA-DNA Hybrid O FRNA O TRNA
The FDA finds that chickens across the US are infected with a new type of bird-flu. They determine the sequence coding for the virus's surface proteins and see that some chickens' viruses have code (1) and some chickens' viruses have code (II). (I) 5' CAUGAUAUUGUACUUU 3' (II) 5' GAAUGGAACUGCAACUC 3' What type of nucleic acid does this virus have? DNA O RNA O RNA-DNA Hybrid O FRNA O TRNA O oo o o
Researchers have been determining the nucleotide sequences of variant forms of SARS-CoV-2, looking for versions of the virus that might be more easily transmitted between humans or that might be more deadly. (a) For example, one mutation in a viral gene changed a GAU codon to a GGU codon. How does this change affect the sequence of the polypeptide encoded by that gene? (b) In another variant form of the virus, a gene is missing six consecutive nucleotides. How would this change affect the sequence of the polypeptide encoded by that gene? (c) In another coronavirus variant, the spike protein (the prominent protein on the surface of the virus) contains a histidine residue where an aspartate (aspartic acid) residue should be. Describe a point mutation in the coronavirus genome that could have caused this change in the spike protein.
Shown is part of the coding strand of the HBB gene involved in sickle cell disease. What will be the effect on the resulting peptide of a deletion of the two nucleotides shown in bold/underline? 5' CTG ACT CCT GAG GAC 3' a) A change from glutamic acid to valine will occur b) The deletion will not result in a change to the polypeptide c) A nonsense mutation will occur d) The polypeptide will be missing one amino acid, but the reading frame will be preserved
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'
Given the sequence below, (A) What is the transcript (MRNA) sequence? (B) What is the amino acid sequence of the translated peptide? Rather than using abbreviations, write out the entire name of each of the amino acids in your peptide, so you do not risk using the wrong abbreviation and, therefore, providing the wrong sequence. 5' - ATG CTT GTA ATA CCG TGA - 3'
Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
5'--TTAATGGGACAGCTTGTGTAGAGG--3' a.) What is the complementary strand of DNA? b.) What is the transcribed mRNA sequence? c.) What is the amino acid sequence translated from the strand of mRNA synthesized in
TRUE OR FALSE a) Primary amines and keto groups of the nitrogen bases are involved in base-pairing in double stranded DNA. b) The unique stem-loop structures of the transfer RNA helps the RNA perform its function of joining ribosomal proteins to form the sites for protein synthesis.
Given this viral mRNA, which model represents the correct (+)ssRNA genome from which it was made? mRNA AUAUUUGCG... O O (+) AUAUUUGCG. (+) UAUAAACGC_ (+) AUAUUUGCG. (+) UAUAAACGC
8.) Answer the following questions regarding the following DNA sequence. 3'TACGGGGATAGCCGGCGAATTAAATAGCTGTC - 5" A.) What is the MRNA sequence that would result from transcription of this sequence? Assume that the DNA would be read from left to right. What is the amino acid sequence that would result from translation of B.) the MRNA resulting from the sequence? See Codon Table on next page. 20 C.) What is the anti-codon found on the tRNA that would deliver the amino acid for the first codon in the MRNA sequence? D.) If the fourth nucleotide in the DNA sequence were deleted due to a mutation during DNA replication, what would the resulting amino acid sequence be? What type of mutation is this? E.) What impact would the mutation in the DNA sequence in PART D have on the function of the protein produced from original sequence? Why?