A one base-pair change in a genetic sequence is called a mutation. revertible frameshift insertion complementation

Q: Which of the following statements regarding complementary molecules in transcription is false?

A: Transcription is the process by which the genetic information encoded in the DNA is copied to the…

Q: How does one label the DNA-strands that look like this ---------------------- ----------------------…

A: The replication of DNA is semiconservative. DNA strands are polymers or chains of deoxynucleoside…

Q: If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is…

A:

Q: An alteration in the DNA from an CG base pair to a AT base pair is called a Select one: O a.…

A:

Q: An insertion of two nucleotides into a gene results in a frameshift mutation.  This statement is:…

A: The nucleotide sequences found within a DNA molecule are subject to change due to a phenomenon known…

Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…

A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: TBP is a eukaryotic DNA binding protein that specifically recognizes the Pribnow box.   True False

A: Introduction: The TATA box binding protein provides instructions for making a protein called TATA…

Q: When half of the DNA in the sample is double-stranded, that point is termed the half- reaction time…

A: Cot values give the renaturation index of the DNA strands. Cot 1/2 value defines that 50%…

Q: In addition to the standard base-paired helical structures, DNA can form X-shaped hairpin structures…

A: Cruciform DNA is a form of non-B DNA that requires at least a 6 nucleotide sequence of inverted…

Q: A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the…

A: To explain--M1: Met-Ser-Ser-Arg-Leu-Glu-GlyThis mutation involves the substitution of Pro with Ser.…

Q: The illumina method of sequencing uses a unique type of nucleotide building block. What is the…

A: The illumina sequencing is a DNA sequencing method used to determine single nucleotide bases of a…

Q: The same DNA sequence as in Questions # 2-4 is rewritten below (Sequence #1). Sequence #2 is the…

A: Gene mutation is the abrupt change in amino acid coding sequence , critically bringing alterations…

Q: Which of the following processes of genetic information flow can occur under lab conditions, but has…

A: The DNA (deoxyribonucleic acid) is the double-stranded molecule which is the genetic material in…

Q: Label the 5'  and 3' end of each nucleotide and approximate where the start point (+1) would be on…

A: The process shown here is called transcription.  In this process a molecule of mRNA is synthesized…

Q: This type of chromosomal rearrangement results in the gain of information.     Duplication…

A: The term chromosomal arrangement refers to the organization and structure of chromosomes within a…

Q: Which of the following sequences is less favorable to find in a folded beta? Select one:…

A: Two types of secondary structures are abundant in protein: alpha helix and beta sheets.  The alpha…

Q: There’s been a murder and four possible suspects are being questioned. A blood sample has been found…

A: SSRs ( simple sequence repeats ) or micro satellite sequences in DNA play a major role as molecular…

Q: a. Write the template DNA (complementary strand) sequence for the wild type gene above  b. Write…

A: The coding strand is complementary to the template strand.  The template strand is the DNA sequence…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: DNA is a nucleic acid formed of two strands of nucleotides. The nucleotides have nitrogen bases that…

Q: Reading from left to right, what is the nucleotide sequence on the other strand of DNA in this…

A: Answer :- D) G-G-C-A-T-A-T-G-T-A Double-stranded DNA takes the form of a helix, sort of a ladder…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during…

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: Protein synthesis or translation process involve at least three steps- In the first step there is a…

Q: Which of the following is required to make complementary DNA (CDNA) from RNA? reverse transcriptase…

A: The central dogma in cell biology is DNA -> RNA -> Protein. The first process is the…

Q: Indicate whether there is matching (1) or base complementarity (2) between the following nucleic…

A: The template strand is also called antisense strand.  Biosynthesis of mRNA using antisense strand of…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: A codon is a triplet of bases which codes for an amino acid. Exons are intervening sequence that are…

A: These are true or false statements. Explanations are given as well.

Q: Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA…

A: Double stranded nucleic acids are formed through hydrogen bonding between complementary nitrogenous…

Q: Which of the following is matched correctly? DNA helicase: unwinds DNA prior to transcription DNA…

A: The study of molecular biology, which includes biomolecular synthesis, modification, processes, and…

Q: The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using…

A: DNA is a double helical structure with two DNA strands. One strand serves as a template for the…

Q: A DNA fragment with the following base sequence has some cytosine bases that are methylated…

A: The bisulfate sequencing is the treatment of DAN with bisulfite before the routine sequencing for…

Q: The first column of the table below shows the beginning of a gene and five different mutations of…

A: Codon is a sequence of three nucleotides that codes for specific amino acid. Codons encode amino…

Q: 1. What is the first codon in the mRNA strand? 2. The second codon in the DNA double helix is TAT…

A: The DNA (deoxyribonucleic acid) that forms the genetic material of an individual contains…

Q: Although A-form, B-form, and Z-form DNA are all left-handed, they exhibit different physical…

A: Nucleic acids are biomolecules that carry genetic information from one generation to the next.…

Q: is the term used to describe the genetic code because a codon specify only for one amino acid is the…

A: 1. The genetic code is UNAMBIGUOUS i.e., each triplet ( codon) specifies only a single amino acid.…

Q: Which of the following statements regarding "start" and "stop" signals apply to both transcription…

A: Introduction  A two-step technique is used to express the genes that code for proteins. A gene's DNA…

Q: Which of the following mutations would likely have the greatest negative impact on the protein…

A: Frameshift mutations are basically known as the most injurious changes to the coding succession of a…

Q: DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the…

A: Deoxyribonucleic acid (DNA) is a double stranded helical genetic material containing thousands of…

Q: Which kind of chemical damage is depicted in this picture: IN H,N NH3 SARA NH DNA DNA Selar Base…

A: Base deletion is a type of mutation in which a base is deleted from DNA. Strand breakage is a…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.