(a) Normal eye (b) Variegated eye FIGURE 19.3 A position effect that alters eye color in Drosophila. (a) A normal red eye. (b) An eye in which an eye color gene has been relocated to a heterochromatic chromosome. This can inactivate the gene in some cells and produces a variegated phenotype. Genes-Traits Variegated eye color occurs because the degree of heterochro- matin formation varies throughout different regions of the eye. In some cells, heterochromatin formation occurs and turns off the eye color gene, thereby leading to the white phenotype. In other cells, the region containing the eye color allele remains euchromatic, yielding a red phenotype. (a-b): © Dr. Jack R. Girton

Q: How can the concept ofrecombination frequency beused in genetic mapping?

A: Recombination is a process of exchange of genetic material between two different organisms.…

Q: MM IV-1 IV-2 III-1 III-2 III-3 A) Using all available information, what is the correct inheritance…

A: Genetic inheritance studies reveal the way a particular gene or a genotype is inherited in the…

Q: An undergraduate researcher in your lab is studying mutations affecting the wings of Drosophila…

A: Alleles of homozygous bent-winged fly which possesses the normal allele of apterous: ap+be, apbe…

Q: In a species of rat, the map unit distance between genes A, B, C and D were as follows: (in the…

A: There are 4 genes : A , B , C , D in the species of rat. Basically ,  Map unit or m.u or cM is the…

Q: . In 1932, H. J. Muller suggested a genetic test to determine whether a particular mutation whose…

A: The rugose gene plays a crucial role in the formation of the correct retinal pattern in the eye. It…

Q: 18 The genes dumpy(dp) and clot(cl) are linked on chromosome II of Drosophila. A heterozygous female…

A: Test cross, in genetics, plays a major role in determining the genotype(dominant or recessive) of an…

Q: What is pseudoagouti (highly methylated) phenotype ?

A: Phenotype generally refers to the observable characteristics of an organism. It is generally…

Q: In addition to the predominant adult hemoglobin,HbA, which contains two α-globin chains and…

A: Crossing over occurs during prophase I of meiosis. The pairing of chromosome occurs at tandem…

Q: What is a heterochronic mutation? How does it affect the phenotypic outcome of an organism? What…

A: Mutation means sudden changes occur in DNA sequences. The mutation occurs randomly. It also occurs…

Q: In a study of a muscle disorder, several affected families exhibited vision problems, muscle…

A: Genes in nuclear content express most of the characters, while some of the characters are associated…

Q: A neutral mutation arises in a diploid population of 10,000 individuals. Use this information to…

A: Mutation refers to a change in the nucleotide sequence of the DNA contained in the genome of an…

Q: At the end of the short arm of human chromosome 16 (16p), several genes associated with disease are…

A: Telomeric DNA are conserved regions at the ends of chromosomes, (TTAGGG)n, approximately 20kb in…

Q: Which type(s) of chromosomal aberrations will suppress recombination in heterozygotes?  A.)…

A: Chromosomal aberrations It is a condition that affects autosomes, sex chromosomes, or both, and is…

Q: If every human gamete contains approximately 30,000 genes and if the forward mutation rate is…

A: Q.   Given Mutation Rate per gene per generation…

Q: Which of the following statements about linkage disequilibrium is false?    a.) A new mutation first…

A: Linkage disequilibrium (LD) is defined as the non-random association of alleles at different loci.…

Q: Insulin is a peptide hormone encoded by the INS gene, which is on chromosome 11. Insulin is produced…

A: The hormone insulin is required by the body to reduce the level of blood glucose. The pancreatic…

Q: If you wanted to make a mouse model for any of the following human genetic conditions (a–d),…

A: Since we only answer up to 3 sub-parts, we’ll answer the first three. Please resubmit the question…

Q: In 1-3 sentences:  define the term and the relationship between the terms (a) Deletion (b)…

A: A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is…

Q: The phenotype of a heterozygous mouse (Aa) is agouti.  The agouti banding pattern is due to altered…

A: * Homozygous dominant and Heterozygous will produce agouti that is AA or Aa respectively  and the…

Q: Evidence [see P. G. Shiels, A. J. Kind, K. H. Campbell, et al. (1999),“Analysis of telomere lengths…

A: As it is given that analysis of telomerase length in cloned sheep suggested that the Dolly may have…

Q: How can you determine whether a phenotype such as reduced eyes in fruit flies is due to a recessive…

A: Phenocopy is the variation in the phenotype that is due to environmental conditions like the…

Q: (6) Which of the following descriptions regarding human genetic variations is correct? A) Unlike…

A: SNPs may effect promoter activity or gene expression, messenger RNA ,conformation stability, and…

Q: 11. Using the hypothetical pathway below, determine what proportion of offspring will be Orange if…

A: In this pathway, the presence of orange colour means the absence of C and the presence of A+ B in…

Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…

A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…

Q: What is the order and interlocus distance between these 3 genes? which gene is in the middle and…

A: In this genetics problem, we are given data on a cross involving three genes in Drosophila: Dichaete…

Q: With the understanding of DNA methylation and gene expression, answer these following questions with…

A: DISCLAIMER FOR MULTIPARTSince you have posted a question with multiple sub-parts, we will solve…

Q: . Below are the DNA sequences that encode the first eight amino acids for five alleles of the Adh…

A: DNA (deoxyribonucleic acid) is the genetic material present in most organisms. The segment of DNA…

Q: If you wanted to produce a fly larvae with two head ends, which of the following would you do?…

A: The pattern formation in drosophila is a complex developmental event that is performed by…

Q: An STR on chromosome 5 is very closely linked to a gene involved in a dominant metabolism disorder…

A: Gel electrophoresis is a technique that is used to separate DNA, RNA or proteins based on their…

Q: Using the conventions of Figure 4-15, draw parents andprogeny classes from a crossP M′′′/p M′ × p…

A: Polymerase chain reaction (PCR) is a process frequently used to swiftly create millions to billions…

Q: (5) Which of the following statements regarding haplotype is correct? A) Haplotype usually refers to…

A: Genetic material of many organisms generally inherited from two parents. The DNA from the parents…

Q: Some people with neurofibromatosis develop blemishes on their skin, while others are severely…

A: Neurofibromatosis is a genetic disorder that causes tumors to form on nerve tissue. These tumors can…

Q: Which type of mutation where a chromosome is found to be shorter that it’s homologous match?

A: Genes are made of nucleic acids called DNA. The variant forms of genes are called alleles. The…

Q: Deletions in bacterial chromosomes give the following data: Region of deletion Al Gene A activity…

A: The gene is located in A3 region. Because deletion of the A3 region leads to the least activity of…

Q: can prevent cancer? 2) Are jumping genes the mechanism by which elephant genes were duplicated?

A: Hyaluronic acid, also called hyaluronan, is an anionic, nonsulfated glycosaminoglycan distributed…

Q: . A diploid strain of yeast was made by mating a haploidstrain with a genotype w−, x−, y−, and z−…

A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: 5.) You have identified a mutant with the following phenotype:  a) Explain what has most likely…

A: Mutation is the alteration in all of part of a DNA of an organism causing the increased or decreased…

Q: a) Let's say the two motif hits (CCACGAG and CCGCCAG respectively) turn out to be evolutionarily…

A: Motifs are mainly short, conserved sequence patterns that are associated with specific function of a…

Q: In an in situ hybridization experiment, a certain clonebound to only the X chromosome in a boy with…

A: In situ hybridization is a sort of hybridization in which a labelled complementary DNA, RNA, or…

Q: More than half of the genome of Arabidopsis thaliana consists of duplicated sequences. What…

A: Arabidopsis thaliana is known to possess diploid and small genome that signifies its usage as the…

Q: Discuss the changes in chromosomes that contribute to the mutations tabulated in Table above

A: A mutation is a change in the nucleotide sequence of DNA that occurs suddenly and permanently. It…

Q: Is the formula "genotype + environment=phenotype" accurate?

A: Genotype  It is the contents of genome. Phenotype   It is the physical appearance.