A group of pesticides are in use at present,these include some types of inorganic chemicals,organic chemicals and other substances.Explain Four major groups of pesticides that give advantages and disadvantages to our life.
Q: Why is the pH of the blood stream lowered during intense exercise? How do muscles obtain MORE oxygen…
A: During intense exercise, our muscles undergo anaerobic respiration due to less availability of…
Q: Why do some microbes produce fermentation end products under anaerobic conditions? O A. to make…
A: Introduction :- When the intake or loss of oxygen exceeds that of its production through…
Q: If the AaBBCc individual will be test-crossed, what is the probability that the resulting offspring…
A: Test Cross: The cross between an organism with unknown genotype and a recessive parents is know as…
Q: In plants known as “morning glory”, the allele for the dominant red-flower color is incompletely…
A: In plants known as morning glory , there are red flowers incompletely dominant over white flowers…
Q: Suppose that you perform an experiment to observe the effect of temperature and pH on the enzymatic…
A: Salivary amylase is an enzyme produced by the salivary glands that aid in the digestion of starch.…
Q: The resting voltage of the cell membrane: O is a property of the cell O is generated by…
A: Cell membrane It refers to the biological membrane that is involved in the separation of the inside…
Q: 5. Very happy Escherichia coli cells reproduce on a 20 minute time frame (doubling or generation…
A: Doubling time is the time in which the cells of E.coli double in their number by undergoing cell…
Q: Completely pubescent (60 hairs/cm³)? Intermediate pubescent (30 hairs/cm)? With 40 hairs/cm²?…
A: Polygenic traits are characteristics controlled or influenced by more than two genes. The genes have…
Q: You are investigating the expression of the dKB gene in the eukaryotic species. dKB mRNA in lung…
A: How eukaryotes express their genes is influenced by a variety of variables, such as gene loss,…
Q: Plasma membranes in the cells of cold-blooded animals usually have a higher proportion of…
A: Introduction: The plasma membrane, also known as the cell membrane, is the membrane found in all…
Q: What are the important microorganisms that affect humans, including bacteria, viruses, fungi, and…
A: There are many different microorganisms that can affect humans, including bacteria, viruses, fungi,…
Q: You inserted your gene of interest in pBR322 as illustrated below. You spliced the vector and insert…
A: Screening The procedure to identify and select the individual of interest.
Q: Explain how PCR/OLA (polymerase chain reaction/oligonucleotide ligation assay) can be used in the…
A: Introduction Sickle cell disorder is a rare condition in which the red blood cells of the individual…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…
A: Given DNA strand: 5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'
Q: Which of the following rows indicates this pregnancy hormone and the correct location of production?…
A: Introduction Pregnancy is an event in which the fertilised egg cell starts developing into an embryo…
Q: is the encysted larva of the beef tapeworm called? a. Cysticerci b. Miracidia c. Cercaria d.…
A: Explanation: 1) Which of the following correctly describes bacteria? Answer: c)arrangements are…
Q: Joanne has AB blood and Henry has AB blood. They have one child with A blood, one child with AB…
A: Introduction The ABO blood group system divides all people into one of eight blood types based on…
Q: outline the factors that negatively affect the viability of microorganisms in aerosols.
A: An aerosol is a suspension of fine solid particles or liquid droplets in air or another gas.…
Q: What is the major difference between the dyssomnias and parasomnias?
A: Introduction: Although a vast range of illnesses and symptoms are covered by the phrase "sleep…
Q: 1. The following are the offspring produced by the cross of AaBBCc X AaBbCC, except: a.AabbCc…
A: In order to study the inheritance of three pairs of factors or alleles from three different genes,…
Q: The following are the offspring produced by the cross of AaBBCc X AaBbCC, except: a. AABBCC b.…
A: Trihybrid cross is the cross between the two individuals of a species for studying inheritance of…
Q: Which one of the following statements regarding antibiotics is FALSE? It is a substance produced by…
A: Antibiotics derived from the microorgansims or produced synthetically ,(wholly or partially) to…
Q: Greg and Susan have Nail- Patella syndrome (NPS). NPS is an autosomal dominant. Greg has a blood in…
A: Introduction The nails, knees, elbows, and pelvis are abnormal in people with nail-patella…
Q: INEPT 1)What happened in the first 90 degree pulse ? 2)What does anti-phase magnetization?(use…
A:
Q: The beach mouse (Peromyscus polionotus) is a small rodent found in the southeastern United States.…
A: Introduction An organism's genotype is made up of all of its genetic components. The alleles or…
Q: 6. Using the observed genotypes in this beach mouse population, what are the frequencies of each…
A: Introduction Allelic frequency defines the frequency or the number of times an allele is present…
Q: 10. Effective population size refers to the number of individuals which can participate in the…
A:
Q: Do as as soon as possible Remain time 20 min left.
A: Solution-Totipotent cells should have the ability to differentiate in vitro into cells…
Q: Which is the correct equation for the chisquare statistic? Group of answer choices a)x^2 =…
A: Chi-square test: This method is used to determine if two variables are independent of one another…
Q: Compare and contrast the four plates. What does each tell you about the experiment?
A: The plates represented here are showing about the transformation of the bacteria. Transformation:…
Q: How do environmental factors such as climate, poverty, global travel, and bioterrorism influence the…
A: Environmental factors influence the rate, probability and susceptibility to transmission of…
Q: Teichoic acid is a major feature of which cell wall? O Fungal Viral O Gram-positive bacteria O…
A: The cell wall is the additional layer present outside of the plasma membrane in some organisms…
Q: The features of the garden pea that made it a basic principles of inheritance •good organism for…
A: Mendel's core theories of heredity made it easier to comprehend how features are passed down from…
Q: Draw the neuromuscular junction and skeletal muscle fiber & provide your reasoning why it's an…
A: Note: As per the guidelines, we are answering the first question here, Please repost the other part…
Q: A positive (not obligate) symbiosis which involves syntrophy (one organism lives off the by-products…
A: In the nature different species interact with each other. According to the nature of the…
Q: A child has sex-linked color blindness, however both parents have normal color vision Please…
A: Color blindness is the X-linked recessive disorder that means it is inherited X-chromosomally and…
Q: A plant X is grown under certain conditions and the seeds have been supplied. How would one check…
A: Solution-Totipotent cells should have the ability to differentiate in vitro into cells…
Q: Which one of the options shown below is a common mechanism of entry in some enveloped viruses?…
A: Viruses are tiny infectious agents that can cause a wide range of diseases in humans, animals, and…
Q: Draw the gametophyte and sporophyte stage of each representatives of nonvascular plants. Label the…
A: The gametophyte stage and the sporophyte stage are the two separate phases of a plant's life cycle.…
Q: Explain the similarities and differences between the green and brown food webs. How are they…
A: Firstly let's understand what green and brown food webs are and then we can move on to their…
Q: You are dispatched to a 35 year old patient complaining of feeling anxious. Based on the above…
A: Anxiety is the most common situation that occurs in the today's stressful situation. The anxiety is…
Q: structure of GLB-1 with haemoglobin and myoglobin, describe in detail why and how GLB-1 has…
A: Beta-galactosidase-1 is an enzyme that aids in the breakdown of lactose while hemoglobin and…
Q: water content of matured seed
A: A seed is defined as the unit of reproduction of a flowering plant, capable of developing into…
Q: Increasing the saturation of the ammonium sulfate is a prerequisite in isolating a target protein…
A: Since you have asked multiple questions, we will solve the first question for you. If you want a…
Q: The K+ channels of the hair cells of the inner ear are an example of: O pumps O antiports O…
A: Introduction The primary sensory receptor cells in the inner ear, known as hair cells, transduce,…
Q: What is believed to be the concentration of bacteria in soil? 109-1010 cells/g dry weight 105-106…
A: Introduction Bacteria are the unicellular living cells/organisms belonging to the domain prokaryote.…
Q: of macrophages?
A: Macrophages are tissue-resident or infiltrated immune cells critical for innate immunity, normal…
Q: Differentiate between micro evolution and and macro evolution. Explain one example or condition that…
A: Evolution is the addition of genetic variations leading to the formation of new species or traits.
Q: Please explain why females are considered genetic mosaics. Please explain how the calico cat shows…
A: Calico cat is a domestic cat . They had tricolour coat that is white, black and orange colour coat.
Q: Refer to the following illustration to answer the questic The illustration shows: O a lysogenic…
A: The transposable genetic element also named as mobile genetic element or jumping genes. They can be…
Step by step
Solved in 3 steps
- The major characteristics of chemical control agents as a group include: (Select all that apply) O They may be placed into 3 groups based on strength of control: sterilants, disinfectants and antiseptics O Their primary function is to kill, inactivate or inhibit growth of microbes O They have different toxicities that govern their safe use. O Some of these are so toxic that they must be used under strict supervision and/or restricted placesOne characteristic of the ideal pesticide is that it would: 1) be of animal origin. 2) be of vegetable origin. 3) quickly break down to harmless products.List and describe the different levels of effectiveness of germicidal chemicals. In that description be sure to mention what they are they do, where they are used, and any limitations they may have.
- Our food supply contains pesticides, hormones, antibiotics, and environmental contaminants. How much of a danger do you think these substances present to our health? How can we minimize our exposure? You can choose just one type of contaminant to discuss.The Hazard Analysis Critical control point is a system that should lead to the production of microbiologically safe foods by analyzing for hazard. a) you discover that the freezer containing the sausages has been off for more than five hours. What would you do with the items in the freezer. GIVE REASONS FOR YOUR ACTIONS.What are the impact of Pharmaceutical industry On Environment? Please Explain this at your own words. Answer should be approximately (400-500 words).
- Describe the physical properties of pesticidesInsecticide formulation plays important role in insect management. Write down different types of dry, wet and aerosol formulations. Write a comprehensive note on the component of Integrated Pest Management (IPM)A pest that requires control measures to be taken regularly and usually this is the focal point of pest management systems?
- The EPA, FDA, and others test food and drink for toxicants and contamination. 1)What Toxicant they test for? How they test for the given toxicant? 3) What do the results mean? (is there a healthy range vs. a dangerous range the testing can determine) 4) What these agencies will do or suggest doing to limit or lower contamination levels.Insecticides play important role in insect pest control, write down a comprehensive note on the classifications of insecticide based on mode of action, mode of entry and based on chemical natureThere are a number of concerns about the chemicals we use in our everyday lives, industry and agriculture. Discuss the effects of these products on the planet and the population. Please address all three aspects and give 3 example of toxins and their effects for each of the three areas.