5. Very happy Escherichia coli cells reproduce on a 20 minute time frame (doubling or generation time). If you start with 2 cells and keep them happy for two hours, how many cells do you expect to have in your culture at the end of the two hours? Try doing it mathematically and then draw it like the left hand side of the Powerpoint growth slide.

Q: Which of the following commits a cell to become muscle cell?

A:

Q: Which is an example of chemotaxis? the attachment of phagocytes to a microorganism by binding to…

A: Introduction  A reaction that takes place within an organism with the goal of protecting it from…

Q: This type of immunity results from the recovery from illness (i.e. having pneumonia). O naturally…

A: Active immunity is the type where our immune system is responsible for protecting against a pathogen…

Q: 15-16. In the fruit fly, vestigial (tiny) wings and hairy body are produced by recessive genes. The…

A: Drosophila is a genus of flies in the family Drosophilidae. Because many species tend to stay around…

Q: Biology The food web of the harp seal is most dependent on which of the following organisms?. 1.…

A: Food-web is defined as "the network of complex interactions among species in an ecosystem"

Q: Which of the following is NOT part of the body's third line of defense? Cytotoxic T-lymphocytes…

A: Introduction Basically, 3 types of line of defense are found in our body :-  Physical and Chemical…

Q: by some type of radiation? Explain step by step with diagrams, physics, chemistry and biology

A: Free radicals are molecules with unpaired electrons. If they are formed and are not removed inside…

Q: Drugs bind to receptor and give response to the body. What type of binding involve in this process ?

A: Receptors are large molecules that play a role in biochemical communication among and inside cells.…

Q: 6. The DNA sequence of a portion of the TEMPLATE strand of a gene is 5'-CAATACGTAC-3'. A. Write the…

A: The Central Dogma theory, in Genetics, states that DNA makes DNA through Replication. DNA makes RNA…

Q: Create a box-and-arrow model that describes: a. how information in the AMH gene results in the…

A: Humans have 23 pairs of chromosomes of which 22 pairs are autosomal and the 23rd pair is sex-linked.…

Q: How are the different biodiversity patterns related to different speciation mechanisms?

A: Speciation The term was first proposed by Orator Cook. It is described as the process of evolution…

Q: D a Which of the following is considered an innate immunity: ● Production of antibodies via B…

A: Immunity is defined as a complex biological system with the ability to recognise and tolerate what…

Q: Which is the correct equation for the chisquare statistic? Group of answer choices a)x^2 =…

A:

Q: 1. Gastric juice has a H+ concentration of 10-3 M. What is the pH of gastric juice? 3 2. The pH of…

A: Introduction :  pH is a numeric scale in chemistry that is used to determine whether the substance…

Q: Refer to the following illustration to answer the question. O protein A is not made because it is…

A: There are some substances (protein, carbohydrate etc) which regulates the expression of genes. For…

Q: coral

A: An organism in which the zygote develops into a discrete unit which then produces more units like…

Q: Fill in the space with the appropriate word from the word-bank below; causing During inhalation, the…

A: Inhalation is the process by which we take in oxygen-rich air. Exhalation is the process by which we…

Q: What is the drug of choice for patient who had S. Aureus culture? Why?

A: Staphylococcus aureus is responsible for a wide range of symptoms and illnesses. Penicillin is the…

Q: Many types of evidence support the evolution of modern species from ancestral forms. Match the…

A: Introduction  Evolution is the gradual change in the inherited traits of biological populations over…

Q: What type of operon is arabinose operon? Dose the repressor bond when arabinose is I present or…

A: Introduction  An operon is a functional segment of Dna that houses a collection of genes that are…

Q: Type of infection for the following and small info about them: E. Balantidiasis F. Sleeping…

A: Introduction  An infectious disease brought on by parasites is referred to as a parasitic disease,…

Q: 2. If individuals from this F1 generation self-fertilize, what genotypes and phenotypes of progeny…

A: The individual genetic makeup makes the genotype, while the physical appearance that one sees due to…

Q: Use the following information to answer the next question.   The end product of glycolysis reacts…

A: The process of converting chemical energy from nutrients into adenosine triphosphate in an…

Q: Telomeres enable DNA polymerase to synthesize new DNA at the tips of the 5' ends of eukaryotic DNA.…

A: Telomerase  Telomeric sequence on chromosomes is maintained by a special enzyme called telomerase.…

Q: From the list below identify the most suitable software used to visualize a change in amino acid on…

A: Understanding the relationship between the protein sequence and its structure helps us to find the…

Q: In pea plants Red (R) flower color is dominant over white (r) flower color and green seeds (G) are…

A: Introduction  Genetics makes a distinction between genotype and phenotype. An organism's entire…

Q: Question 25 All of these are features of an autosomal recessive pedigree EXCEPT: O Heterozygotes…

A: Pedigree is a chart that represents a family tree. It displays members of a family affected by a…

Q: The cell membrane surrounds some smaller molecules in solution and takes them into the cell. This is…

A: Introduction: A bilayer forms the cell membrane. This is composed of phospholipids with polar,…

Q: ITEM I MSM MICROBIAL PROFILE MICROORGANISM/CAUSATIVE AGENT GRAM REACTION A B OXYGEN REQUIREMENT C D…

A: Malaria is brought on by a type of protozoan called Plasmodium falciparum. Malaria is a serious…

Q: 10. Transpiration is a vital process in plants wherein water in the form of vapor leaves the system…

A: Introduction :- Water vapour is lost via the process of transpiration through a plant's stomata.…

Q: What is heterozygote advantage. How does this phenomenon explain the preponderance of disorders such…

A: Introduction  Each gene has two alleles, or variations. When two identical copies of a gene are…

Q: Black, sepia, cream, and albino are coat colors of guinea pigs. Individual animals (not necessarily…

A: Genes are carried on chromosomes, and each guinea pig has 64 of them. The mother provides 32…

Q: In radishes long radish L is dominant over short radish. A farmer cross pollinates a long radish…

A: Introduction  The relationship between two variants of a gene is described as dominant. Each gene…

Q: These are released by host cells in response to viral stimulation. Some act to prevent viral…

A: Introduction  A virus is an infectious microorganism made up of a protein-coated segment of nucleic…

Q: Describe two roles where ABA shows to be rather ecological and physiological significance to the…

A: Abscisic acid (ABA) is a crucial hormone that plays a significant role in regulating responses to…

Q: Using a named example, discuss the advantages of using E. coli to produce recombinant proteins.

A: Recombinant DNA technology defines the artificial manipualtion of the genetic material to create the…

Q: Discuss using named examples strategies that could be used to develop an effective vaccine for the…

A: Zika Virus: Zika virus is an arbovirus that belongs to the flavivirdae family, which includes…

Q: When a pathogen (or its toxins) enters the blood, the infection can spread throughout the body. Such…

A: The correct answer is ' systemic infection'.    Systemic infection means affecting the entire body…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Given DNA strand:  5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'

Q: The resting voltage of the cell membrane: O is a property of the cell O is generated by…

A: Cell membrane It refers to the biological membrane that is involved in the separation of the inside…

Q: Please explain mitochondrial DNA inheritance . How is it inherited ? Why is it predisposed to…

A: The cell contains the nucleus, which includes the cell's genetic material called nucleic acid. The…

Q: If a woman is heterozygous dominant and her husband is recessive for a genetically inherited trait…

A: A diploid organism having two different types of alleles is said to be heterozygous. Individuals…

Q: water sanitation.

A: Water sanitation is defined as the process of cleaning and purifying water so it is safe for use.…

Q: Which of the following is true of an infectious disease? they can be spread from one host to another…

A: Disease is a specific abnormal condition that negatively affects the structure or function of an…

Q: Which of the structures manufactures rRNA?

A: Introduction rRNA, also called ribosomal RNA is a non-coding RNA that forms the major part of the…

Q: QUESTION 9 When an atom loses an electron it is then called a cation. O True O False QUESTION 10…

A: Acids and bases can be defined in many ways Acids have more H+ ions while bases have more OH-…

Q: Refer to the following illustration to answer the question. V2 S Rearranged DNA in B lymphocyte V250…

A: DNA is the genetic molecule which carries genetic information .

Q: Cross a mouse homozygous for white fur with a mouse homozygous for black fur

A: The condition where two identical genes are present In an individual for a particular character, is…

Q: water content of matured seed

A: A seed is defined as the unit of reproduction of a flowering plant, capable of developing into…

Q: Do as as soon as possible  Remain time 20 min left.

A: Solution-Totipotent cells should have the ability to differentiate in vitro into cells…