A 3YO 31lb child with edmena has been ordered furosemide 2mg/kg PO once daily. Furosemide oral solution is available in 60mL bottles containing 10mg/mL. How many mL will you administer each day?
Q: Give typed explanation
A: During meiosis, homologous chromosomes, which have the same genes but may carry different alleles,…
Q: A pig digestive system and reproductive system Provide a investigation of how the fetal pig organ…
A: There are several parallels between the digestive systems of foetal pigs and humans. Both systems…
Q: stages
A: A single cell divides into two identical daughter cells during the process of mitosis (cell…
Q: ▸ A tissue consisting of many layers (columnar at the basement membrane, cuboidal in the middle, and…
A: Tissue can be defined as a group of similar cells that usually have a common embryonic origin and…
Q: Give at least (3) body structures that are salient among these groups of animals: 1. Arthropods 2.…
A: Taxonomy is defined as the science of naming, describing and classifying diverse organisms based on…
Q: Animal Group Protozoa Porifera Typical Environment Integration
A: In the animal kingdom, a staggering diversity of life forms exists, each with unique characteristics…
Q: what is the importance of eukaryotic cells?
A: Cell is chief elemental unit present in the body and on the basis of type , it is categorised as :-…
Q: Give typed explanation Which of the following is the correct order of events of coagulation? (1)…
A: The mechanism through which blood transforms from a fluid to a gel and forms a blood clot is…
Q: Identify the community interaction that best corresponds to the following example:" Lichens look…
A: A pack of wolves in a forest represents the population level of organization in an ecological…
Q: QUESTION 20 The response of a post-synaptic cell to a neurotransmitter that opens ion channels…
A: The junction between two neurons is known as a synapse. During chemical synapse, neurotransmitters…
Q: glucocorticoid glucocorticoid cell membrane cytoplasm responsive element nucleus nuclear membrane…
A: Glucocorticoids are a type of steroid hormone that is produced naturally by the adrenal glands or is…
Q: In Caenorhabditis elegans, the level of expression of genes on both X chromosomes of females is…
A: The process by which the information encoded in a gene is converted into a function is known as gene…
Q: The dominant white allele (W) is a homozygous lethal and is dominant over the full-color allele (w)…
A: In this genetic scenario involving horse coat color, we have two genes at play: one for white color…
Q: Description of macropreparation:
A: The term "macropreparation" pertains to the characterization of a tissue or organ specimen, more…
Q: Where are interneurons most commonly located? central nervous system effectors sensory nerves…
A: These questions delve into the intricacies of neural transmission and the consequences of renal…
Q: 2. Dosage compensation in mammals typically involves the random inactivation of one of the two X…
A: Black male (XbY): Can produce two types of gametes, Xb and Y."Calico" female (XBXb): Can produce two…
Q: Describe how the data are presented in the figure “0%”. Compare the presentation of data seen in…
A: This question involves the analysis and interpretation of data related to dog behavior and magnetic…
Q: How would you approach this problem? You plan to sequence the following DNA by Sanger sequencing.…
A: Sanger sequencing, developed by Frederick Sanger in 1977, is a widely used method for determining…
Q: [Na+] high K+] low [Na+] low [K+] high excess + charge excess - charge 3 Na+ 2 K | I ↑ 3 Nat 2 K+ 2…
A: An animal's cell, the plasma membrane has a transmembrane protein pump called the sodium-potassium…
Q: Country United States: Similar: Similar: Different: Different: Different: Per-capita Ecological…
A: CountryPer-capita ecological footprint per - capita biocapacityNaturally capital deficit (-)or…
Q: Given the following DNA sequence: 5'ATTGGCTGTTAAAACCGGTGCCTGGGCATCGTTGGA3' Part A Write the mRNA…
A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…
Q: describe what happens to any undigested food or waste products.
A: Digestion is a process whereby the large insoluble food compounds are broken down into small water…
Q: is to say, the excitatory pathways become over ive, or the inhibitory pathways, esigned to temper…
A: Normally neuron has a resting membrane potential of about -70 millivolt. When an action potential…
Q: Give an overview of the different characteristics of the major animal phyla using the table below…
A: In the animal kingdom, a staggering diversity of life forms exists, each with unique characteristics…
Q: .
A: Zika , Dengue and Chukunguya virus diseases are mosquito-borne diseases caused by dengue virus (…
Q: Staphylococcus epidermidis on the skin is an example of Mutualism Normal microbiota Opportunistic…
A: Staphylococcus epidermidis is a Gram-positive bacterium that is one of over 40 species in the…
Q: electrons electron distribution harm living organisms valence electrons charge distribution atoms…
A: These paragraphs talk about the basic structure of an element, how the molecules and atoms play an…
Q: (15) (14) (13) 2 5 (10) (11) 8
A: Animal cells are conventional eukaryotic cells since they have a nucleus bound to the membrane and…
Q: For Black or Brown bears Identify the biotic and abiotic factors that affect the community as well…
A: The Biotic and abiotic factors play pivotal roles in the ecosystems inhabited by Black and Brown…
Q: How are protozoa classified according to: Number of Cells Size of Cells Presence or Absence of…
A: Protozoa are a diverse collection of single-celled eukaryotic microorganisms with various…
Q: CH₂ Cr 1. Which of the structures is a nucleotide? [Select] 2. Which of the structures is a steroid?…
A: The living organisms are made up of cells. Cells contain different biomolecules that are the…
Q: What is the Description and Examples in the body of these Cell transport? Explain in 2-3 sentences…
A: Description: Diffusion is the natural, passive process where molecules disperse from regions of…
Q: Specimens Hexactinellida Anthozoa Trematoda Scaphopoda Oligochaeta Myriapoda Echinoidea…
A: Cladogram is a diagrammatic illustration which explains evolutionary relationship among the species.…
Q: Which of the following statements is not true about enzymes? Are protein catalysts Are very specific…
A: The statement that is not true about enzymes is:"Composed of long chains of monosaccharides."Enzymes…
Q: Explain What happens in each of the 3 phases of growth?
A: Growth is a quantitative data that represents increase in the mass of the body. Growth is one of the…
Q: Vildtype pea plants have inflated pea pods and round seeds. Constricted pea pods and wrinkled seeds…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: A. You cross a true-breeding sunflower, with yellow flowers and black seeds, with another…
A: True-breeding plants are those that consistently produce offspring with the same traits as the…
Q: Capstone ideas for veterinarians
A: Veterinary medicine is the branch of medicine that deals mainly with the prevention, diagnosis and…
Q: Suppose researchers identified two Drosophila melanogaster mutant phenotypes. One phenotype is…
A: Answer :- To determine the mode of inheritance for the genes controlling maniac and shiny, we can…
Q: Which of the following is an example of a catabolic pathway? Synthesis of complex molecules from…
A: Within a cell, a biochemical reaction is the conversion of one molecule to another. Enzymes, that…
Q: Sex-reversed females with XY were found to be missing SRY gene on their Y chromosomes, while…
A: Sex determination in humans is a complex process impacted by the combination of sex chromosomes and…
Q: In the 1960s, it was common practice to prescribe multiple antibiotics to fight bacterial…
A: Antibiotics are medications designed to act against bacteria. These medications either work by…
Q: Give at least (3) body structures that are salient among these groups of animals: [Body structure:…
A: Body structure is a specific intricate body portion of a living creature. It is composed of several…
Q: Identify the following structures in a DNA molecule:
A: The following structures marked in the DNA structure of the given question are.....I. Deoxyribose,…
Q: A liter of a TPN solution contains 500 milliliters of 50 percent dextrose solution and 500…
A: To determine the daily energy and protein intakes of a person receiving 2 liters per day of the TPN…
Q: 10. Based on the following phylogenetic tree, which of the following conclusions are "NOT correct?…
A: Phylogenetic tree is defined as the diagrammatic representation of evolutionary relationships among…
Q: Match the proteins with their function in DNA replication. unwinds DNA at replication fork forms…
A: The correct matching of proteins with their functions in DNA replication:Unwinds DNA at replication…
Q: Examine the pedigree and answer the following questions; shaded individuals show the trait;…
A: The pedigree analysis helps us to understand the mode of inheritance of a particular disease by…
Q: 39. How does the sodium-potassium pump help to make the cell interior negative! 4 It pumps negative…
A: Answer :- The sodium-potassium pump, also known as the Na+/K+ pump, is a transmembrane protein found…
Q: Animal Group Protozoa Porifera Typical Environment Typical Lifestyle of Adult Form Integration…
A: In the animal kingdom, a staggering diversity of life forms exists, each with unique characteristics…
A 3YO 31lb child with edmena has been ordered furosemide 2mg/kg PO once daily. Furosemide oral solution is available in 60mL bottles containing 10mg/mL. How many mL will you administer each day?
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- a 5 yo 38lb child with a mild infection is to reive oral amoxicillin 40mg/kg/day in divided doses every 8 hours. the amoxicillin is available in 150 mL bottles containing 250mg/5mL. How many mL will you administer per dose?What does IV admixture mean? Do the following medication an IV admixture? If not what are they? Norepinephrine 16mg in 250ml D5W Dexmedetomidine 200mcg in 50ml Fentanyl 100mcg in 10ml NSS Midazolam 30mg in 30ml NSS Potassium Chloride 40meq in 1L PLR 1 literA 72kg male diagnosed with bacterial meningitits has an order for gentamicin 5mg/kg/day IV in divided doses every 8 hours. How many mg will you administer for each dose?
- Clindamycin 150mg PO every 6 hours is ordered for a child weighting 40lb 10oz. the recommended dose is 8-25mg/kg/day in three or four divided doses. On hand is Clindamycin 75mg/ml oral solution. If safe, how many ml will you give?An 8kg infant is prescribed Clindamycin 60mg PO Q6hrs. The safe dose range is 25-40mg/kg/day in divided doses every 6-8 hours. The Clindamycin package is 75mg/ml. How much should the nurse administer in mLDaisy (7 years old; 30 kg) is admitted to hospital for meningitis and requires a short intravenous infusions of cefotaxime. A dose of 50 mg/kg is recommended every 6 hours for the first 4 days. Only 2 g cefotaxime vials are available. The powder in the vials is dissolved with 4.0 mL of saline. Calculate the volume (in mL to 1 d.p.)of this solution which should be transfered to the 40mL syringe driver for a single infusion.
- A 13 kg child is to receive fentanyl 15 mcg every hour IV prn pain. The recommended safe dose range is 1-2 mcg/kg/dose every 30-60 min PRN. Is the ordered dose safe?A nurse is preparing to administer tobramycin 2.5/mg/kg to a child that weighs 20kg. avaiable is tobramycin injection 40mg/ml. how many mL should the nurse administer per dose? (round to the nearest tenth)A 42 YO adult male weighing 142lb, wo is being treated for HSE (herpes simplex enceplhalitis), has been prescribed acyclovir 10mg/kg/dose IV q 8h for 14days. Acyclovir for injection is available in 10 and 20 mL vials containing 50mg/mL. a) How many mg will the patient receive each day? b) How many mg will the patient receive each dose? c) How many mL will the patient receive each dose? d) How many mL will the patient receive each day?
- The nurse is preparing to give Acetaminophen to a 5year old girl weighing 20 kg. The doctor has ordered Acetaminophen 240mg PO qehr PRN pain. the safe dose range for acetaminophen is 10-15 MG/KG/dose. What is the low safe amount per dose? [1] What is the high safe amount per dose? (2) is this dose safe to give? (3]Calculate the amount to dispense for each of the following orders. When more than one dosage strength is available, choose the most appropriate. 1. Ordered: Azithromycin 1 g po daily for 5 days On hand: Azithromycin 500 mg tablets