
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Topic Video
Question

Transcribed Image Text:6. The following diagram shows a replication bubble within a double stranded DNA molecule. The red arrow shows
the direction of the primer.
AAAGIACGTIGAC ATTGGCC 3'
TAACCGG 5'
5' GTCCGAC
3' CAGGCAG
C.
5
CAT&CAACTO
a. What is the sequence of the red RNA primer?
b. If the replication fork moves to the left (left side opens more), will this primer be used to create the leading
strand or lagging strand? Please explain your answer.
If you answered the leading strand, explain why replication is continuous. However, if you answered lagging
strand explain why replication is discontinuous.
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 5 steps

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 14. Guanine normally pairs with cytosine. Oxidative damage can result in the modification of guanine to 8-oxoguanine. What is the potential mismatch in nucleotides that can occur following replication? 8-oxoguanine pairs with Adenine 8-oxoguanine pairs with thymidine Thymidine pairs with adenine Guanine pairs with Cytosine None of these choices. Question 8 The key enzyme that transfers an a-amino group from an amino acid to an a-keto acid is : Glutamate Dehydrogenase Transaminase Synthetase Glutamine PRPP Amidotransferase Glutaminasearrow_forward6.You have used the primer 5' CTGA 3' in a DNA sequencing reaction with the template DNA sequence shown below. DNTPS, DNA polymerase and ddTTP were also added. Write out the sequence of 4 DNA fragments you expect to produce in your sequencing reaction. Include the 5' and 3' ends of each fragment in your answer. 3' AAGACTCGATCGATCGTTTCCTCA 5'arrow_forward11. please fill in the blanksarrow_forward
- 33.Choose the DNA nucleotide sequence that would be complementary to the following strand (note: pay attention to DIRECTION of replication): 5' GTAGTCA 3' a 3' UATUAGA 5' b. 5' TGACTAC 3' 3' ACGACTG 5' 5' UGACUAC 3'. 5.Using agarose gel electrophoresis to analyze DNA, short DNA travels the long DNA. a faster than slower than at the same speed as d. Question 6 Which type of bonds link the individual nucleotides together in DNA? Glycosidic bond Peptide bond Phosphodiester bond Electrostatic bond a e Hydrogen bond Question 7 A typical engineered plasmid vector often contains the following features except a A poly linker region Origin of replication A signal peptide An antibiotic resistant gene a. b. C. C. d.arrow_forward5. DNA is made of two strands that are antiparallel. If one strand runs from 3' to 5' direction the other one will go from 5' to 3' direction. During replication or transcription, whatever the process is, it will always follow the 5' to 3' direction using the 3' to 5' directed strand as the template strand. Therefore, if following is the DNA sequence 5'-CCG ATC GCA CAA-3' a) Using this sequence as template after transcription no protein can be translated. Why? I. Presence of start codon II. Absence of start codon III. Due to mutation b) If you want to start the translation, what change you need in the second codon (from 5' to 3' direction)? I. Substitution of C with G II. No change III. Deletion of C IV. Both I & IIIarrow_forward1) Fill in the following replication bubble. Be sure to draw and label the origin of replication (both sides), the leading and lagging strands, & the 5' and 3' ends of alI DNA fragments. 5' 3'arrow_forward
- 13arrow_forwardThis is an absolute stumper. Would you be able to assist with drawing and labeling would look like in this scenario?arrow_forward12. Shown below are three possible mechanisms for DNA replication. Identify which each kind is (semiconservative, conservative, or dispersive). I Which model is this? (select one) A. Semiconservative Conservative Dispersive Semiconservative Conservative Dispersive Semiconservative Conservative Dispersive B. C. XXX< XXXXXX XXX< x< XXXXXXXX XXXXXXXxXxXx XXXXXX MXXXXX XXxxxxxX XXXXXXarrow_forward
- Answer A, B, C all of themarrow_forward1. Name all the proteins that are in the DNA replication fork in E. Coli, and describe the functions of these proteins. Explain how two DNA strands are replicated at the same time by one replication fork.arrow_forward1. From the given DNA strands:a. Identify the template and non-template strand.b. Give the mRNA product when the DNA is transcribed.c. What is the resulting amino acid sequence which will result from the mRNA?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education