5' 3' • TGT • • ACA • DNA 3' 5' IT TGT АСА TG C АCG TGG АСС TIT TGA АСТ Mutation U ĠŮ UGÅ Transcribed codon Cysteine Cysteine Tryptophan Stop codon Amino acid translated Wild type Silent Missense Nonsense Outcome mutation mutation mutation FIGURE 8.3 Potential Outcomes of Base Substitutions Outcomes include silent, missense, and nonsense mutations. in
Q: From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change one base in codon 8 to…
A: The genetic material of the cell, that is, the DNA (deoxyribonucleic acid) comprises various coding…
Q: The new DNA codon would be GAT. This would code for the mRNA codon CUA, which would translate into…
A: Introduction DNA:- It is the hereditary material in humans and almost all other organisms, Your…
Q: G. Aureliano has a mutation in the blue-shaded nucleotide in the TEMPLATE DNA sequence. Instead of a…
A: A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of DNA copying…
Q: 5. A DNA sequence of "ACG" will code for the amino acid - (LS1- 1) * Second mRNA base C. UUU Phe UUC…
A: Gene expression refers to the complex, highly-regulated biological process, which involves the…
Q: missense mutation: D Adds a base OProduces a different amino acid O Deletes a base O Causes a…
A: The mutation is the change in the original nucleotide sequence of DNA resulting in the change in…
Q: The coding strand of DNA in a segment of a gene is as follows:ATG GGC CTT AGC. This strand carries…
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: Identify the mutation. Original DNA: TAC CCG AAT GGC ATT Mutated DNA TAC CCG AAC GGC ATT Use the…
A: To identify: The mutation in the given DNA sequence
Q: 2. What are IC TArE Codon marks theste at wNch translati PART D. Directions: Identify the mutated…
A: In the given question the normal DNA is TAC-CCC- GTC- ACC- GCC- TAT-ATC. The normal RNA formed from…
Q: TAC CTA CTC TAG TTA ACCACA GTT GCCATC Transcribe the given template strand of DNA:I Second mRNA base…
A: The Genetic code is : 1. Universal 2. Redundant 3.Non Ambiguous Genetic Codon have start and stop…
Q: Match up the DNA mutation with its description: Silent a. a point mutation where one amino acid is…
A: Silent - g) a point mutation where the amino acid sequence are unchanged Missense mutation - a) a…
Q: Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a…
A: The mutation occurs when there is a change in the nucleic acid sequence. These mutations could be…
Q: Codon in Codon in Amino Acid DNA template strand MRNA APP gene in individuals 3'-CAA-5' 5'-GUU-3'…
A: Alzheimer's disease causes the brain's atrophy to shrink and the cells of the brain to die. Dementia…
Q: DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCG GCT CTC CCA…
A: DNA is the genetic material present in the cells of living beings.
Q: Transcription/Translation Practice WS MRNA TRNA Amino AUU GUA His Acid DNA ATA ССА MRNA ERNA UUC Trp…
A: Central dogma explains the flow of genetic information from DNA to RNA to proteins. The process of…
Q: Can you please do 26, and 27
A:
Q: 4 sports = Gly, Val 8 legs = Val, His, lle, Tyr Straight antennae = Ala, lle, lle Start codon = AUG…
A: Introduction AUG(Met) GG(U, C, A, G)(Gly) GU(U, C, A, G)(Val) CA(U, C)(His) AU(U, C, A)(Ile) UA(U,…
Q: . (a) Which codon is the start codon in the mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 AAU…
A: Ans - a.) AUG is the start codon in the mRNA 5 - AAUAUGCGGAUGCCCGAA -3. # AUG acts as initiator…
Q: 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Amino Acid 4. DNA (3'-5') AAG GTC…
A: Introduction: DNA: A deoxyribonucleic acid It is the hereditary molecule in the organisms except…
Q: A point mutation within a codon that does not change the resulting amino acid sequence is known as…
A: Mutation is a change of nucleotide sequence of DNA. When there is a change in single nucleotide of…
Q: A particular DNA coding segment is ACGTTAGCCCCAGCT. Write the sequence of nucleotides in the…
A: DNA is the genetic material present in our body and RNA encodes for protein molecules. DNA and RNA…
Q: (A) Nonsense mutations (i) result in addition of one or more nucleotides (B) Transversion mutations…
A: Mutations are the changes in the DNA sequence. These are natural. The mutations may or may not…
Q: Original DNA Sequence: TACAC CTTGG CGACGACT... MRNA Sequence: Amino Acid Sequence: Mutated DNA…
A: In the formation of mRNA from DNA, base complementarity rules follow. A pairs to U and T pairs to A.…
Q: A silent mutation is a mutation in which: a. one nucleotide in a codon is changed, but the codon…
A: Mutations are a sudden change in the nucleotide sequence of a gene that alters the amino acids and…
Q: Can you please answer number 28 and 29
A: Any alteration in the genome’s nucleotide sequence is called a mutation. Any agent that results in a…
Q: (a) Which of the following statements is TRUE? DNA polymerase moves in a 5 to 3 direction in…
A: The biological process by which the information encoded inside a DNA (deoxyribonucleic acid)…
Q: Shown below is a nucleotide sequence alignment consisting of corresponding sequences of the same…
A: A change in the normal specific DNA sequence that can arise due to the anomaly is DNA replication or…
Q: The Deoxyribonucleic Acid (DNA) is made up of What type of mutation does not affect a proteii 1.…
A: DNA It is a heritable molecule which transfer from parents to their offsprings. It contains all the…
Q: C G T G T G GAGCT A A.. 3' 5'..A TG GCG CTGTGA AGC TA A.. 3' 5 . .A TGG CGCT CTG GAGCTA A.. 3' on…
A: Mutations of the spontaneous change in the DNA molecule. Synonyms mutations does not change the…
Q: If the first G changes to A what kind of mutation will happen? Show the change in amino acid…
A: When there is an error in the DNA sequence during replication it causes a change in the DNA…
Q: Show the effect of the following types of mutation on the 5th N-base of the given DNA sequence. Use…
A: A missense mutation is a mistake in the DNA which results in the wrong amino acid being incorporated…
Q: The original DNA sequence TACACCTTGGCGACT I need the mRNA sequence and the amino acid sequence And…
A: mRNA Sequence: A U G U G G A A C C G C U G C U G A Amino Acid Sequence: METHIONINE…
Q: Identify the type of mutation and how it would affect the protein made (amino acid) if the following…
A: Mutations can be defined as the sudden changes which occur in DNA. These changes can be a result of…
Q: A mutation in DNA that changes a glutamine codon, CAA, to a stop codon, UAA, is called a O…
A: Mutations can occur as a consequence of DNA copying errors during cell division, exposure to…
Q: A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…
A: Mutation is defined as sudden inheritable change that occurs in the DNA sequence. It may be…
Q: What amino acids are specified by the following base triads on DNA? a. TCA b. CCt c. GGC d. GAT e.…
A: A genetic codon is a triplet nucleotide sequence of RNA molecules that were formed from the…
Q: A mistake during DNA replication leads to a mutation in the nucleotide sequence shown below. DNA DNA…
A: Mutations are a genetic phenomenon in which alterations in the sequence of nucleotides of DNA occur.…
Q: 4 sports = Gly, Val 8 legs = Val, His, lle, Tyr Straight antennae = Ala, lle, lle Start codon = AUG…
A: For 4 spots, 8 legs and straight antennae the peptide would be Met-Gly-Val-His-Ile-Tyr-ala-Ile-Ile…
Q: Mutation #2: • Change the Mutation to RED TACACC IIGGCGACGACT AUGUGG A ACCG CU G CUGA MET -TRP- ASN…
A: Original DNA sequence TAC ACC TTG GCG ACG ACT mRNA sequence AUG UGG AAC CGC UGC UGAAmino…
Q: 5. A DNA sequence of "ACG" will code for the amino acid (LS1- 1) * Second mRNA base U UUU Phe UCU…
A: Each codon in mRNA is made up of three nucleotides, and each codon indicates a certain amino acid…
Q: A Section of a Gene AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the…
A: \protein synthesis in a cell is a very important function. The information for protein synthesis is…
Q: A mutation creates a STOP codon where one was not before. Which of the following could NOT h O…
A: All genetic variety comes from mutation, which provides the raw material for evolutionary forces…
Q: An original DNA sequence retrieved from the gametes of a female Golden Retriever and a mutated DNA…
A: DNA is two stranded structure , present bin double helix and is a genetic material in most of…
Q: 1. (a) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base."…
A: 1.(a) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base."…
Q: DNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCG GCT CTC CCA…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: ads 5' to 3' right to left. The nucleotides are numbered 1 to 100. REMINDER: For thi oblem,…
A: The central dogma of molecular biology is a metabolic process of cell where one strand of the double…
Q: Gly Leu (F) (L) Glu Asp (D) Ser (S) Tyr Ala (A) GUC Cys (C) G U Val (M) U GNP (W). Arg (R) G A C Leu…
A: Any change in the genetic material, which is not caused by recombination, that leads to altered…
Q: 2. A reversion is a mutation that returns a mutant codon back to a codon that gives a wild-type…
A: Reversion mutation is one that causes such a change in the gene that does not cause change in…
Q: This figure shows a single nucleotide addition. What would happen if three nucleotides were added?
A: Mutations are changes made to the nucleotide sequence of the DNA. Mutations may be caused by…
Q: A certain section of the coding (sense) strand of some DNA looks like this: ATGCTAGAGTGA It's known…
A: Given: Coding strand: 5'-ATGCTAGAGTGA-3' So we have, Template strand: 3'-TACGATCTCACT-5' The mRNA…
Q: TATAA AUG UAA Only known regulatory region TSS Mutation C. 3 nucleotides Mutation B: 20 nucleotides…
A: Mutations are the changes in the DNA sequence that may or may not have an effect on gene function…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Which of these outcomes is most likely to result in a leaky mutation?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?10:39 E DNA/RNA/PROTEIN SYNTHESIS/M... 18 of 20 A DNA nucleotide is composed of what three parts and are held together by Phosphate, ribose, nitrogenous base and held together by hydrogen bonds Phosphate, deoxyribose and held together by hydrogen bonds Phosphate, ribose and held together by covalent bonds Phosphate, deoxyribose, nitrogenous base and held together by hydrogen bonds Next > II
- Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde / Human DNA sequence ATG TGT CCA TTA ACG TGC ACA Name the codon that is formed from base triplet number 2 on the DNA sequence. Write down the names of the amino acids coded for by base triplets 6 and 7. Write down the full names Draw the structure of the dipeptide Thr-Cys at pH7. Clearly indicate the following: the amino terminus (N) the carboxyl terminus (C) a peptide bond an α-carbon atom If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed? E.The following is a sequence of base triplets in DNA F.If guanine, found in the first base…First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…
- RNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…oseg 1su Third Base ne following questions refer to Figure 17.2, a table of codons. Second Base nnn UUC UAU non Tyr UCC UAC UGA Stop dois UGG UUA JOS UCA UAA ne UUG UCG UAG di dois CCU CAU CGU CUC SIH CGC CCC CAC CUA no7 CGA CCA Old CAA CCG CAG CGG AAU AUC JOS USV AGC ACC AAC AUA ACA AAA AGA AUG Met or Start Lys ACG AAG GCU GAU dsy GGC GUC GCC GAC Ala Gly GUA GCA GAA GGA GUG GCG GAG GGG Figure 17.2 A peptide has the sequence NH2-phe-pro-lys-pro-gly-phe-pro-COOH. Which Of the following sequences in the coding strand Of the DNA could equal the code for this peptide? a. 5' GGG-AAA-TTT-AAA-CCC-ACT-GGG b. 5' TTT-CCC-AAA-CCC-GGG-TTT-CC c. 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG d. 3' UUU-CCC-AAA-GGG-UUU-CCC e. 5' TTT-CCC-AAA-GGG-TTT-CCCBM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
- pen+ GEAR Normal DNA Normal RNA Amino Acids Mutant DNA Mutant RNA: Name: FRAMESHIFT MUTATIONS occur when a base is added (or removed) from 8. Determine the amino acid chain coded for by the following sequence. Supp another A is added after the first codon. Complete the chart showing the amir normal and mutant sequence. Amino Acids Investigation: DNA. Proteins. and Mutatic TGG AGT CGA GGT TGG AAG TCG AGG T Why are frameshift mutations likely to cause more problems than a p 9. Cystic fibrosis is a disease that causes mucus to build up in th misshapen protein in the cell membrane which interferes with the popociated with the disorderotein structure urs Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase Unanswered 0 0/1 answered III I III A compound with no electrical charge made up of separate molecules with positive and negative charges that balance each other out. Attaches the appropriate amino acid to a tRNA molecule based on its anticodon. Surprisingly contains a thymine in it despite being a piece of RNA. Recognized by the anticodon UAC. Small group of proteins that assist protein folding. SubmitSecond letter C A UUU Phenyl- UUC alanine UCU UCC UAU UAC UGU UGC Tyrosine Cysteine Serine UCA UCG UAA Stop codon UAG Stop codon UGA Stop codon UGG Tryptophan UUA A Leucine UUG CCU ССС CAU CAC CUU CGU CGC Histidine C CUC C CUA Leucine Proline Arginine CCA СCG CGA CGG A CAA CAG CUG Glutamine AGU AGC AUU AAU ААС ACU Asparagine Serine AUC Isoleucine A AUA ACC АСА Threonine AAA AGA Methionine; start codon ACG Lysine Arginine AUG AAG AGG U GUU GUC GUA GCU GCC GCA GAU Aspartic GAC acid GGU GGC GGA GGG Valine Alanine Glycine GAA Glutamic GAG acid GUG GCG G Given the codon UCA in the first exon of a gene, which change is most likely to result in a nonsense mutation? A transversion of A to U Change of nucleotide in the third position Change of nucleotide in the first position A transition of A to G Change of nucleotide in the second position First letter Third letter