4. A peptide was cleaved into smaller fragments using chymotrypsin and CnBr. The fragments were separated by HPLC and then sequenced by Edman degradation. Determine the sequence of the original peptide from the following fragment sequences. Cleavage with chymotrypsin Cleavage with CnBr EAGPDGMECAF ЕCАFHR GPF CKWEAGPDGM EAAMCKW IAHTYGPFEAAM HR ТАНТY -align the peptides Reagent (source) Trypsin (bovine pancrease) Chymotrypsin (bovine pancrease) Staphylococcus V8 protease Pepsin (porcine pancrease) Cyanogen bromide (chemical)(CnBr) Specificity Lys, Arg (C) Phe, Trp, Tyr (C) Glu, Asp (C) Phe, Trp, Tyr (N) Met (C)

Q: What would be the 5 first nucleotides that form the mRNA?

A: Transcription is an important step in the gene expression in eukaryotes and Prokaryotes. It involves…

Q: • Using the RNA base abbreviations hairpin structure below which would allow a stable hairpin to…

A: DNA is usually present as double-stranded molecules. The A-, B-, and Z-form of DNA are the three…

Q: Obj 29. Identify the specific terms applied to the process of protein synthesis described by each…

A: Epinephrine, also known as adrenaline, is a hormone and neurotransmitter that plays a critical role…

Q: A deletion mutation occuring in the region of DNA which encodes for a sigma subunit of RNA…

A: Mutation is sudden, heritable change in the sequence of the genome that give rise to alternate form…

Q: RNA codon table 2nd position G 1st A 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Cys…

A: Three consecutive nitrogen base on mRNA is called genetic code which determine a specific amino…

Q: Product(wrong) Substrate(wrong) Ku+ nil Ꮩw . IVW Pre-translocation ky+ ky+ KIV+ / niv Err* k₁. ky-nG…

A: High fidelity gene transcription and replication require kinetic discrimination of nucleotide…

Q: You discovered a halophilic bacterium and want to characterize the mechanism involved in producing…

A: The tRNA (transfer RNA) takes part in polypeptide synthesis by bringing in the amino acid to the…

Q: 3) mutated:3' TA C A CC TTG coA CGA CTA'S MRAA transcript: AuG uCG AACGCU Gcu GAu. amino acid:…

A: A mutation is a change in the DNA sequence of an organism. Mutations can result from errors in DNA…

Q: Apeptide was sequenced and the sequence of fragment sets generated by different cleavage methods is…

A: Amino acids are the molecules that join to form a protein structure. The bond formed between two…

Q: 2. Given a DNA template molecule of 5'- ATGGCTCCTACCTACTAGTTAACATATGG-3', generate the mRNA sequence…

A: We are given a sequence of DNA in 5'-3' direction.  We have to generate the mRNA sequence and then a…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: 1.The -glycosidic bond in uridine phosphate exist between a) C1 of ribose and N9 of uracil b) C3 of…

A: 1. The glycosidic linkage involves c-1 of sugar and the hydrogen atom of N-1 in uracil 2 Promoters…

Q: For each of the following sequences, fill in either the DNA, the MRNA sequence, or the amino acid…

A: The central dogma is referred as the central processing system which includes the transfer of…

Q: A C mRNA (Met Gly F GGG AUGCCCACG UAG Which letter indicates the amino end of the growing…

A: A covalent link known as a peptide bond connects the carboxyl group (-COOH) of one amino acid to the…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Which set of fragment ions is likely from the same population of precursors ions (parent peptide)…

A: ANS:- None of the described choices are likely.

Q: The following eukaryotic DNA is transcribed into RNA and the mRNA transcript is translated into…

A: mRNA:  Messenger RNA (mRNA) is a type of RNA molecule that carries genetic information from the DNA…

Q: The transcribed portion of a DNA sequence for a gene is shown below. Identify the MRNA sequence and…

A: The procedure of determining the order of the four nucleotide bases (adenine, thymine, cytosine, and…

Q: Describing Functions: Building Vocabulary Skills In your own words, define each of the following in…

A: Translation process takes place in the cytoplasm of the cell. It involves tRNA, mRNA, large and…

Q: Be sure to answer all parts. Consider the following mRNA sequence: 5'-GCU AGG CGA-3'. a. What amino…

A: Translation is the process in which the m rna is converted into a polypeptide chain of amino acids…

Q: D C 5' 3¹ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F)…

A: Transcription is the process by which mRNA is synthesized from DNA. Translation is the process of…

Q: In the following gel showing stained bands of the Alu insertion sequence, what is the gem of…

A: In the gel, the presence of a band at 941 bp indicates the presence of the Alu insertion sequence,…

Q: Transcription and Translation Practice Directions: Read each sequence of DNA and transcribe it to…

A:

Q: What is the net charge of the peptide at pH 7 that is synthesized from this DNA sequence? 5'…

A: As we know that the DNA sequence exhibits codons, which helps in the formation of mRNA, and then…

Q: You have identified a mutation. In the normal organism the DNA TEMPLATE strand is 5'AGT3' in the…

A: Mutations are changes in the sequence of DNA which may or may not affect the phenotype of the…

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: How many activation cycles, Initiation cycles, Elongation cycles and termination cycles are needed…

A: Protein synthesis occurs in four main steps such as activation or charging of tRNA, initiation of…

Q: Given Sequence: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ PLEASE PROVIDE THE RANSLATION OF THE FOLLOWING:…

A: The template strand is from 3` 5` and a coding strand of DNA is from 5` to 3`. The synthesis of m…

Q: EF-Tu: EF-Ts as ORF-1:RF2 eEF1A:eEF1B O Shine-Dalgarno:5'-7mG O Co-translation: post-translational…

A:

Q: The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were…

A: Enzymes can catalyze several reactions and aid in speeding up a reaction. There are several enzymes…

Q: below One common structure found in "folded" SSRNA is a • Using the RNA base abbreviations: A, G, C…

A: Stem-loop is the structure formed by single-stranded RNA (ribonucleic acid) when nucleotides base…

Q: Two complete sets of overlapping peptides, created with two different cleavage methods, are used in…

A: The technique used to determine the amino acid sequence of a protein is known as protein sequencing.…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?

A: A genetic mutation known as a deletion occurs when one or more nucleotides are lost from a DNA…

Q: 1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that…

A: The amino acids in the given sequence are leucine, tyrosine, glycine, glycine, and valine.

Q: A short protein segment was cleaved by two different enzymes resulting in two sets of degradation…

A: Edman degradation is a method in which amino acids can be sequenced in a peptide. At first the amino…

Q: Identify the following mutations and describe what the possible effect on the protein will be. (4)…

A: Mutation in general refers to the change in one or more gene. Some are negligible while others can…

Q: I only need letter D and E

A: There is a group of three bases in an mRNA. This group of three bases comprises a codon. Each codon…

Q: Ser STP Tyr Val Ulla Unigriffin DNA: | CAT AGG GAG | CAA GGG TGA CTT TTT | AAT AAT GAC GGG | MRNA:…

A: DNA :CAT AGG GAG CAA GGG TGA CTT TTT AAT AAT GAC GGG RNA: CAU AGG GAG CAA GGG UGA CUU UUU AAU AAU…

Q: Which of the following amino acid sequences would yield the most optimal oligonucleotide probe?…

A: In molecular biology, the amino acid sequence is defined as the protein or peptide with a linear…

Q: me e File Content Edit X view Tator Biol 140 X BOBILI Content X Begin:…

A: This worksheet is related to  transcription and translation which are related to the synthesis of…

Q: If tRNALeu is mutated so that it is recognized by the tRNAVal synthetase but not the by tRNALeu…

A: Introduction  Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: Give typing answer with explanation and conclusion The following gene codes for a liver enzyme.…

A: We need to figure out which choice would cause a mistake in the DNA sequence by changing the A/T…

Q: 8. Which statement/s about RNA is/are true? (Select all that apply.) * RNA is made through the…

A: 8.RNA stands for ribonucleic acid.It act as a genetic material in a viruses.It also play essential…

Q: Based on the N-terminal amino acid sequence, what is the approximate half-life of the protein after…

A: Introduction- N-terminal methionine cleavage plays an important role in protein synthesis in…

Q: What is the mRNA transcribed from the "anti-sense" strand of this DNA shown below? 5' TATGGC 3'.…

A: Given: Messenger RNA (mRNA), a molecule in cells that carry codes from DNA in the nucleus to areas…

Q: Which of the following sequences would pair best with this sequence: 5'-CGATTCGA-3' O 5'-UCGAAUCG-3'…

A: In DNA, the nitrogenous bases adenine (A) pairs with thymine (T), and cytosine (C) pairs with…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.