How would you calculate the amplicon in DNA! 23. Consider the double stranded template DNA (The top strand 5' end is on the left)and two primers (Primer 1 and 2). Each primer is 15 nt in length. Primer 1hybridizes to the bottom strand at the position highlighted in bold. Primer 2hybridizes to the top strain (in bold).53Galle15 bp in length1CCTAATCCGATCCCGACAGTTTTGCTCCATGAATCCGATCGACCTCGCGAG 3GGATTAGGCTAGGGCTGTCAAAACGAGGTACTTAGGCTAGCTGGAGCGCTCCTC 5'Primer 1:5'TAATCCGATCCCGAC 3'PPrimer 2:5CGAGGTCGATCGGAT 3'primer 2a.If this DNA is used in a PCR reaction, how long will the amplicon be? Inputa number 45(bp)allegos.b. What is the first nucleotide added by DNA polymerase to Primer 2? Inputa nucleotide base (G, A, T or C) G

Amplicon is a segment of DNA that is amplified and this contains replicated genetic material. Two…

23. Consider the double stranded template DNA (The top strand 5' end is on the left) and two primers (Primer 1 and 2). Each primer is 15 nt in length. Primer 1 hybridizes to the bottom strand at the position highlighted in bold. Primer 2 hybridizes to the top strain (in bold). Galle 3 5` CCTAATCCGATCCCGACAGTTTTGCTCCATG|ATCCGATCGACCTCGŁGAG 3` V GOATTAGGCTAGGGCTETCAAAACGAGGTACTTAGGCTAGCTGGAGCGCTC 15 bp in length Primer 1: 5'TAATCCGATCCCGAC 3' Primer 2: 5'CGAGGTCGATCGGAT 3' primer 2 a. If this DNA is used in a PCR reaction, how long will the amplicon be? Input a number 45 (bp) allegos b. What is the first nucleotide added by DNA polymerase to Primer 2? Input a nucleotide base (G, A, T or C)____G

23. Consider the double stranded template DNA (The top strand 5' end is on the left) and two primers (Primer 1 and 2). Each primer is 15 nt in length. Primer 1 hybridizes to the bottom strand at the position highlighted in bold. Primer 2 hybridizes to the top strain (in bold). Galle 3 5` CCTAATCCGATCCCGACAGTTTTGCTCCATG|ATCCGATCGACCTCGŁGAG 3` V GOATTAGGCTAGGGCTETCAAAACGAGGTACTTAGGCTAGCTGGAGCGCTC 15 bp in length Primer 1: 5'TAATCCGATCCCGAC 3' Primer 2: 5'CGAGGTCGATCGGAT 3' primer 2 a. If this DNA is used in a PCR reaction, how long will the amplicon be? Input a number 45 (bp) allegos b. What is the first nucleotide added by DNA polymerase to Primer 2? Input a nucleotide base (G, A, T or C)____G

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 27CTQ: Transcribe and translate the following DNA sequence (nontemplate strand): 5'- ATGGCCGGTTATTAAGCA-3'

See similar textbooks

Similar questions

8. You have a piece of DNA with the sequence shown below. 5-AAAGTCGCTGGAATTCACTGCATCCCCGGGGCTATATATGAATTCGATGCGTACTTGGCACG-3' 3'TTTCAGCGACCTTAAGTGACGTAGGGGCCCCGATATATACTTAAGCTACGCATGAACCGTGC-5' You cut this fragment with the restriction enzyme EcoRI. The recognition site for EcoRI is 5-GAATTC-3' 3-CTTAAGS" EcoRI cuts at the site and in the manner indicated by the arrows to yield fragments with overhanging ends. 3-СТТААG-5' 5'G AATTC-3' 3-СТТАА G-5' Draw an illustration showing how the piece of DNA is cut by EcoRI and how many fragments result. Show all the base pairs and the overhanging ends at the ends of the DNA fragments.
25. Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand. DNA AAT GGT CCA CCG CTG 1TI 111 11 T Ou GGT GGC GIC MRNA Amino Acids UUA = leucine %3D GAC = asparginine GGU = glycine GGC = glycine CCA = proline %3D AMAM b iwi tant neto10 e 2obitoabun St
1. On a piece of paper, replicate the following segment of DNA: 5’ ATCGGCTACGTTCAC 3’ 3’ TAGCCGATGCAAGTG 5’ a.) show the direction of replication of the new strands and explain what the lagging and leading strands are. b) Explain how this is semiconservative replication. Are the new strands identical to the original segment of DNA? 2. Createyour own an Illustration of the Central Dogma. Provide your own DNA segment. Use the previous topics as reference.
5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?
25. The restriction enzymes Kpnl and Acc651 recognize and cleave the same 6-bp sequence. You have a plasmid and a linear DNA strand that both contain a Kpnl and Acc651 sequence in the same orientation as shown below. You digest both DNA pieces with both enzymes and then attempt to ligate the sticky ends, followed by treatment with DNA ligase. What will happen? 5' GGTACC3' 5' G G T ACC 3' 3' CCATGG 5' y CCATGGS Kpnl Acс651 A) You will produce sticky ends but the two types of ends will not ligate. Instead, you may produce a small amount of religated plasmid where the digested plasmid sequence re-inserts. B) You will produce a recombinant plasmid in which the linear DNA strand is ligated in between the two sites, suitable for cloning. C) You will produce blunt ends that will not ligate because the two restriction enzymes will both operate on both of the sites. D) All the DNA will be completely digested as if you had applied a general DNAse enzyme.
3. In the following drawing, the top strand is the template DNA, and the bottom strand shows the lagging strand prior to the action of DNA Polymerase I. Three Okazaki fragments are shown and the RNA primers (asterisks) have not yet been removed. 3'- -5' 5********** RNA primer Left Okazaki fragment ↑ RNA primer ↑ -||- Middle Okazaki fragment -||- *********** RNA primer Right Okazaki fragment -3' A. Which Okazaki fragment was made first, the one on the left or the one on the right? B. Which RNA primer would be the first one to be removed by DNA polymerase I, the primer on the left or the primer on the right? For this primer to be removed by DNA polymerase I and for the gap to be filled in, is it necessary for the Okazaki fragment in the middle to have already been synthesized? Explain why. C. Let's consider how DNA ligase connects the left Okazaki fragment with the middle Okazaki fragment. After DNA polymerase I removes the middle RNA primer and fills in the gap with DNA, where does DNA…
Image 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given below ? 5’ACTGAGTCCATGCGATCATGACTAT 3’ 3’TGACTCAGGTACGCTAGTACTGATA 5’ this is a hypothetical example. In a real experiment Choose 5’ TGAC 3’ 5’ CTAT 3’ 5’ ACTG 3’ 5’ ATAG 3’ Image2. the template strand?The results of a gel-based sequencing experiment are shown below. What is the sequence, written Only include nucleotides (no spaces or numbers )
5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
Design primers that will amplify the following region of DNA (assume this is one strand from a double stranded region of DNA). The primers should be 15 bases in length. Indicate the 5' and 3' ends of the primers. 5' GGATCGATCAAGAACAATGACAGGATCGAGGAATTCAGCCTACGCAGCCCGTAGCTGGAGGGA 3'
5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3' 3' CACGATCGCCCTTACTCGACCCTATGATCATCCCGA 5' Template Strand: 9. Using the template strand, transcribe the DNA above, Be sure you write your sequence 5 - 5 a indicate the 5' and 3' ends of any nucleic acid molecule(s). 10. Use the codon chart below to translate your mRNA into an amino acid sequence. Begin at the first codon. Third First position (5' end) Second position position (3'end) UGU Cys UAU Tyr Cc UGC Cys UGA Stop UGG Trp UCU Ser -Y UAC Tyr UAA Stop UAG Stop UUU Phe - F UUC Phe UUA Leu UUG Leu FL UCC Ser -- UCA Ser UCG Ser CGU Arg CGC Arg ER CGA Arg CGG Arg CCU Pro CAU His CUU Leu CUC Leu -- CAC His CAA Gln CAG Gln CCC Pro -P A - CUA Leu CUG Leu CCA Pro CCG Pro AAU Asn AAC Asn AGU Ser AGC Ser AGA Arg ACU Thr AUU lle AUC lle AUA lle AUG Met M ACC Thr -T ACA Thr ACG Thr A. AAA Lys K AAG Lys -R AGG Arg A. GAU Asp -D GAC Asp GGU Gly GGC Gly GCU Ala GUU Val GUC Val GCC Ala A -G GGA Gly GGG Gly A -V GUA Val GUG Val GCA Ala GCG Ala GAA Glu -E…
22..2 if one strand of the DNA molecule has the sequence 5’ TACGA 3, The other strand would have the sequence: 3’ UACGCA5’ 3’AUGCGU 5’ 3’ ATGCGT 5’ 3 TACGCA 5’ 3’ ATGCGT 5’
10. A picture of a replication bubble is shown below. でイトイOpイ TT 3 Primer 5'-CUU-3" is being used to replicate this picce of DNA. What strand this primer will anneal to: the upper or the lower? Write what product of RNA replication would be the first five nucleotides that had been added onto the primer by DNA pol. Mark the 5' and 3' ends. lin