2. Assume 250 base pairs to be responsible for a particular portion of mRNA molecule. What is the length of that stretch of mRNA in a) angstrom (A)? b) micrometers (mm)?
Q: Nitric oxide produced by the endothelial layer of blood vessels stimulates the smooth muscle layer…
A: The ability of internal communication was established from protista group. In course of evolution,…
Q: protein: Sterol transport protein Identification of an orthologue present in humans A description of…
A: * Orthologous genes are originated by descent from single gene of last common ancestor like that the…
Q: 1. What is an unusual feature of the nervous network of cnidarians?
A: Nervous network of cnidarians :-
Q: Canine Scott Syndrome (CSS) is caused by a mutation in the splicing consensus motif in the TMEM16F…
A: * canine Scott syndrome is an inherited blood clotting disorder which affects the dogs. * The dogs…
Q: An individual with an argininosuccinase deficiency is administered benzoate and arginine. This…
A: Argininosuccinase deficiency is a condition where the cells are devoid of an important enzyme i.e.…
Q: The sequence of the start of the c-Myc gene is as follows (first picture): Use this information to…
A: Transcription takes place on the strand called as template strand it has a polarity of 3' - 5', thus…
Q: What does a rabbit need that it makes for materials found in it’s environment
A: All living things have basic needs, same way the rabbit needs food, water and shelter to live in.
Q: What are the habitat corridors in the Philippines?
A: The main function of the corridors is to connect biodiversity areas through a patchwork of…
Q: Rainforests have over ______of all species of plants and animals on earth. A. a quarter B. Half C.…
A: Rainforests are forest ecosystems characterized by high levels of rainfall, an enclosed canopy and…
Q: Explain why chytrids are considered an ancient fungal group.
A: Microscopic organisms are referred to as microorganisms. Bacteria, archaea, protozoa, algae, fungi,…
Q: After a naive B cell encounters a 1 and binds an antigen with its2 it enguifs and degrades the…
A: Immune cells are of two types: B -cells and T-cells. The B-cells which has never encounter any…
Q: Characteristics of Life / Living Things of a dandelion.
A: Dandelion It is a species of plant and belong to the phylum of angiosperms.
Q: Vhat is the driving force behind divergent evolution? Explain.
A: Divergent evolution happens when a populace of animals or plants is parted into two gatherings by a…
Q: Describe the growth and reproduction of a zygote fungus
A: A fungus is a type of eukaryotic creature which comprises microorganisms like yeasts and moulds,…
Q: Which of the following polysaccharide will be MORE VISCOUS at acidic pH? a. cellulose O b. amylose O…
A: Viscous means difficulty in flow of liquid or solutions. Polysaccharides forms by linkage of 2 or…
Q: What is outgroup analysis?
A: An outgroup is a collection of creatures that acts as a benchmark for determining the ingroup's…
Q: 2. If instead of 20 amino acids there were 200 amino acids, then how many nucleotides would you be…
A: Answer :- Option (A) is correct. - 3.
Q: I want to know about the safety of antibiotics used in pregnancy in different trimesters.
A: Introduction - Antibiotics, usually referred to as antibacterials, are drugs that kill or slow the…
Q: Examine the following karyotypes and answer the questions about each karyotype in the table below.
A: Karyotyping is the process of pairing chromosomes and ordering them on a map or in simple terms it…
Q: .Define autosome, hemizygous, homozygous, and heterozygous?
A: Genes Genes are basic unit of heredity. They are present on the DNA.
Q: What is the shape of bacteria under a microscope, what color is there, and is there Gram staining is…
A: Gram staining also known as Gram's method is a staining method used to distinguish and classify…
Q: .What is the bottleneck effect?
A: Introduction In this question we will discuss about the
Q: Question 21 Use the information in the diagram below to answer the questions. R A \U .K A) Which…
A: The age or time of rock formations determined by the location of rock under the earth layer. Fault…
Q: Sphingolipids do I. contain a glycerol core with a phosphocholine headgroup. II. contain a modified…
A: The entire structure of sphingolipids does not show the presence of glycerol molecules. Glycerol…
Q: how does a sea shell become the golden ratio?
A: Love and fecundity are typically associated with seashells. The seashell can be seen as a symbol of…
Q: Which co-receptor molecules are common to both TC and TH cells and their respective antigen…
A: The CD2-LFA-3 and LFA-1-ICAM pathways relevance to T-cell recognition
Q: Biology You are analyzing a qPCR experiment and obtain the following results. The slope of the gDNA…
A: Answer:- Thia is a qPCR experiment result. From this slope I trust the quantities for my unknown…
Q: What do you mean by "survival of the fittest"?
A: Natural selection is a process of adaptation by the organism to the changing environment by bringing…
Q: Many microbes (as well as other organisms) produce antibiotics. A natural compound produced by one…
A: *Many microbes like fungi and algae and bacterial and other organisms will produce antibiotics. *An…
Q: 1. In humans, hair form is an autosomaltrait showing incomplete dominance. Hair can be straight,…
A: In incomplete dominance blending of traits occur as dominant allele does not completely mask the…
Q: Starting with acetyl-S-enzyme-1 and malonyl-CoA, how many molecules of acetyl-CoA synthesize an…
A: * Acetyl CoA is a molecule that involves in many biochemical reactions like protein and…
Q: Place the following structurees of the internal kidney in the correct order in which urine passes…
A: Kidneys can be referred to as bean-shaped organs associated with filtering wastes present in blood…
Q: Is a trisomic an aneuploid or a polyploid?
A: Trisomy is a genetic condition in which an extra chromosome or part of a chromosome is added to a…
Q: A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence on the…
A: Answer
Q: Question 31 Lipids, aside from their structural and energy storage functions, are also able to…
A: Lipids are composed of hydrocarbons and for this reason they are hydrophobic in nature. Different…
Q: Animals with a negative EPD for days to 90 kg (market weight) will produce offspring that reach…
A: EPD is a analytical tool which enables an animal breeder to select the best parent to breed. EPD…
Q: How many phosphates, deoxyribose and nitrogenous bases are there in a DNA that has 15
A: DNA is a polymer of nucleotides. Two DNA strands lie side by side with their complementary bases…
Q: In root morphology there are three zones. What are the three zones and what roles do they play?
A: The root tip has three main zones: a zone of cell division (cells are actively dividing), a zone of…
Q: Why Provide the structure of any such fatty acid. omega-3 fatty acids called essential fatty acids?…
A:
Q: A farmer notices that plants growing closest to his house are shorter than those growing further…
A: * For growth of plants the minimum factors should be required for its growth or else plant will not…
Q: What is considered a disadvantage of phenotypic diagnostics compared to genotypic approaches in the…
A: Disadvantage of phenotypic diagnostic over genotypic approaches:-
Q: Questions:- Which of the following statements is incorrect about celiac disease? Group of answer…
A: ANSWER;- B.Celiac disease is entirely driven by gluten exposure, but it presents with the…
Q: What is the shape of the bacteria in the pictures under microscope ( Cocci or Bacilli ) and why with…
A: Bacilli and cocci are different shaped bacteria and they named according to their shape . The…
Q: Dynamic instability causes microtubules either to grow or to shrink rapidly. Consider an individual…
A: Microtubules, along with intermediate filaments and microfilaments, make up the cell skeleton, which…
Q: Please give examples of red meat, white meat and lean meat.
A: Introduction - Only mammalian or chicken (not fish) flesh is classed as red or white in the culinary…
Q: Using Figure 17-37, calculate what percentage of conceptions are triploid. The same figure shows XO…
A: Introduction A zygote is a fertilised egg cell produced by the union of a female gamete (egg, or…
Q: 2. Describe the difference between light and electron microscopes. 3. Briefly describe the function…
A: Introduction - 1. A microscope is a laboratory instrument used to examine objects that are too small…
Q: If you wanted to increase the sensitivity of a BLAST search, how would you adjust the T parameter?…
A: * BLAST is also called as Basic Local Alignment Search Tool which refers to a program used to…
Q: Based on Figure 17-35, write a sentence stating howtranslocation can lead to cancer. Can you think…
A: Translocations were discovered cytologically for the first time in the late nineteenth and early…
Q: In the fatty acid degradation of the following molecule: How many Acetyl CoA, NADH, and FADH2 will…
A: The fatty acids are degraded by beta-oxidation that occurs within the mitochondrial matrix and…
Step by step
Solved in 2 steps
- Assume 102 nucleotide pairs of DNA to be responsible for transcription of particular mRNA molecule. What is the length of that mRNA in (1) angstrom? (2) in micrometers?Refer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)For each of the five short mRNA nucleotide sequences given in the table below: 3. Translate the original sequence (for these short sequences start translation at the first nucleotide) 4. Identify (and highlight or underline) the one nucleotide difference between the original (left) and altered (right) sequences 5. For each altered nucleotide sequence give the type of mutation (effect at the DNA/nucleotide level; see #1 above) 6. Translate each changed sequence. Does the mutation result in a change in the amino acid sequence? If so, what is the effect of the mutation on protein structure (amino acid sequence; see #2 above)
- (a) Write the complementary base sequence for the matching strand in the DNA section shown below:. 5’ – A T G T T A C T A G T C – 3’ (b) The following section of DNA is used to build an mRNA for a protein: 3′—AAG—CTT—CTC—5′. What is the corresponding mRNA sequence?Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
- (a) Write the complementary base sequence for the matching strand in the DNA section shown below:. 5' - ATGTTACTAGT C-3' (b) The following section of DNA is used to build an MRNA for a protein: 3'-AAG-CTT-CTC-5'. What is the corresponding mRNA sequence?2) Create an MRNA strand based on the given DNA template strand: TACTTCCTATTITCTTGTCA CCGCACT 3) Using the mRNA codon chart, determine the amino acid sequence for the MRNA sequence determined in question 3. 4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA Template Strand: TACACATCACGCTCAACT a) What would be the amino acid sequence coded for by the template strand of the DNA molecule above?If mature eukaryotic MRNA is hybridized with its corresponding genomic DNA template strand and visualized by electron microscopy, two types of structures are seen: RNA:DNA double-stranded heteroduplexes and single stranded DNA loop structures, as shown in the diagrams below. What do you think these single stranded DNA loops represent? (a) Micrograph of DNA-RNA hybrid (b) Interpretation of micrograph Single-stranded DNA only Single-stranded DNA base paired with MRNA Select one: а. Exons b. Introns c. 5' UTR d. 3' UTR e. promoter
- (a) Write the sequence of the mRNA molecule synthesized from a DNA template strand having the following sequence:5'–ATCGTACCGTTA–3' (b) What amino acid sequence is encoded by the following base sequence of an mRNA molecule? Assume that the reading frame starts at the 5’ end.5'–UUGCCUAGUGAUUGGAUG–3! (c) What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free proteinsynthesizing system?Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code tableSickle cell anemia is a widespread disease in many African countries and can be caused by a change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with the disease and a genetic fingerprint reveals the following DNA sequence for the gene: (a) (b) (c) (d) (e) Write down the mRNA sequence for the given DNA sense strand indicating the polarity. Derive the polypeptide from the mRNA molecule using the table of the genetic code (Table Q1 below) again indicating the polarity of the peptide chain. Indicate the position in the DNA molecule that could have caused the disease and write down all possible point mutations in the DNA sequence that could have caused it. [ The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write down all possible t-RNA molecules with their anti-codons that are used to polymerize the amino acid VAL. Indicate the polarity. 3'-TAC TGA GCA AGA TTA CAT ACT-5' Explain what is meant by redundancy of the genetic code.…