18. Amino acids at the N-terminal end of eukaryotic polypeptides that contain information required for post-translational processing and determining the extra-cellular destination of the nascent polypeptides. Group of answer choices 1. Sigma Sequence 2. Signal Sequence 3. Chaperone Sequence 4. Kozak Sequence

Number 10) Please put the following steps of eukaryotic protein synthesis in order from first (1) to last (4) _ 5' cap    _ translocation out of nucleus                                                             _ splicing                                                                        _ primary mRNA

i struggled with my homework and i need help

Which of the following statements about tRNA molecules is TRUE? Multiple Choice TRNA assumes a double helical shape Every base in a tRNA molecule pairs with another base in the same tRNA strand, leading to its higher levels of structure Bases in the tRNA loops do not pair with any other bases The amino acid is attached to the central loop region of the tRNA molecule All of the answers are correct.

Answer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? elongation ⚫ Which position shows the "A" position? middle (contains blue tRNA) . Which end of the RNA is the 5' end? left end • Which base of the anticodon of the blue tRNA "GAC" (as shown in the diagram) is the end of the anticodon? the C CUAGAC AGAUCUGCUACUAGUAACACGU

In posttranslational modification, phosphates are attached to which 3 amino acids?  - tyrosine - serine - proline - lysine - threonine

Answer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? elongation • Which position shows the "A" position? right side (no tRNA) • Which end of the RNA is the 5' end? left end • Which base of the anticodon of the blue tRNA "GAC" (as shown in the diagram) is the 5' end of the anticodon? the C U! UCUGCUACUAGUAACACGU

16S sequence information will be composed of: As and Us and Cs and Gs that make the mRNA sequence dn As and Ts and Cs and Gs that make up the DNA sequence amino acids that build the ribosome amino acid codons that make up the mRNA small enzymes that build the ribosome