I. What is the correct order of enzyme action during DNA replication? Number the steps from 1 to 7.HINT: Refer to the slide show and video lecture on this topic to help you solve this one:Synthesis of RNA primers (priming)LigationII. A double-stranded DNA molecule with the sequence shown below can produce a polypeptide that isfour amino acids long. Identify which DNA strands are the coding and the transcribed template strandsby circling C or T to the left of the table below, respectively. Use an arrow to indicate the direction oftranscription. In the table, show the mRNA sequences and amino acids in this peptide. In spaces tothe left and right of the table, label all 5' and 3' ends of all relevant nucleic acid strands.READ CAREFULLY: The table gives you the possibility of filling in answers that show transcriptionfrom either strand or in either direction. You are only required to fill in the information relevant toONE PEPTIDE (no others). Refer to the genetic code on the following page. HINT: While we read andwrite in 2D from left to right, in the 3D world of a cell there is no such restriction on reading andwriting associated with transcription or translation.AAmRNAC or T TAC ATG ATC ATT TCA CGG AAT TTC TAG CATmRNAHelicase/topoisomerase activitySingle-stranded binding proteins bind and prevent reannealingDNA polymerization/proofreading5'-3' exonuclease activity/DNA polymerizationBinding to origin of replication (AT rich sequence)AA1.C or T ATG TAC TAG TAA AGT GCC TTA AAG ATC GTA CATTTIf the bottom strand is transcribed from left to right, the 4th tRNA anticodon isthe amino acidin the 4th position of the nascent polypeptide.First letterGENETIC CODEIf the upper strand is transcribed from right to left and a nonsense mutation occurs in the 3rd codon,the last tRNA anticodon iswhich inserts the amino acidin the last position of thenascent polypeptide.сGUUUUUCUUA:]UUGCUUCUCCUACUGAUUAUCAUAAUG]GUUGUCGUAGUGUPhenylalanine(Phe)Leucine(Leu)Leucine(Leu)Isoleucine(Ile)Methionine(Met)Valine(Val)UCUUCCUCAUCGCCUCCCCCACCGACUACCACAACGGCUGCCGCAGCGCSecond letterSerine(Ser)Proline(Pro)Threonine(Thr)Alanine(Ala)UAU2]UACUAAUAGCAUCACCAACAGAAUAACAAAAAGGAUGACGAAGAG]]]ATyrosine(Tyr)StopStopHistidine(His)Glutamine.(Gln)Asparagine(Asn)Lysine(Lys)Aspartic acid.(Asp)Glutamic acid(Glu)CGUCGCCGACGGUGUUGCUGAStopAUGG Tryptophan G(Trp)AGUAGCAGAAGGGGUGGCGGAGGGلالا, which inserts]GTACysteine U(Cys)Arginine(Arg)Serine(Ser)Arginine(Arg)Glycine(Gly)DCAGUАUDCAG1.1.1. I.

Name: I. What is the correct order of enzyme action during DNA replication?
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: I. What is the correct order of enzyme action during DNA replication? Number the steps from 1 to 7.HINT: Refer to the slide show and video lecture on this topic to help you solve this one:Synthesis of RNA primers (priming)LigationII. A double-strand