Each set consist of five key players in the process involved in the central dogma. Choose ONLY two items that perform same fuction. 1RPAPCNASSBPTFRFTFRFPeptidyl transferaseeRFDNA helicaseDNA ligaseDNA pol aDNA pol IIDNA topoisomeraseRNAse HReplication forkDNA pol IDNA gyraseDNA pol a2.3.4.

DNA in a cell undergoes replication process to duplicate the DNA and transfers the duplicated DNA…

Answered: Each set consist of five key players in…

Each set consist of five key players in the process involved in the central dogma. Choose ONLY two items that perform same fuction.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 27CTQ: Transcribe and translate the following DNA sequence (nontemplate strand): 5'- ATGGCCGGTTATTAAGCA-3'

See similar textbooks

Related questions

Q: What is meant by the committed step?

A: Enzymes are known as the biological catalysts of the body. These are made up of tertiary or…

Q: Can you please help answer this question base on the graph it shows?

A: In the image given, a scatter plot has been shown which shows a significant correlation between mean…

Q: What does orad mean?

A: Orad is a scrabble word that means towards the mouth or towards the oral region. Oral region is also…

Q: Match the mutation type with the correct example.

A: Mutation is any alteration or modification or change in the nucleotide sequence, resulting in a…

Q: What are central dogma?

A: The deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains. It coils around…

Q: Loss of function mutation results in a _ allele.

A: Mutations are sudden changes in the gene sequence. When these changes causes loss of function of an…

Q: How can taking pieces of DNA from one organism and putting it into another organism: Be beneficial:…

A: The application of scientific and technical principles to the processing of the material by…

Q: please help with question Clearly STATE your NULL hypothesis

A: The null hypothesis is a statistical theory that states that there is no statistical relationship or…

Q: Who is the father of genetics

A: Genetics is the branch of biology that deals with heredity and gene variations.

Q: Discuss the concept of the null hypothesis and its use indata analysis.

A: Null hypothesis (H0) — it is a type of guess or speculation used in statistics that proposes that…

Q: Explain the central dogma

A: Answer- Central dogma for biology was postulated by Francis Crick in 1958.

Q: Using the data comparing the DNA sample from the wealthy man to the possible relatives, which…

A: Ans. The gel picture shows bands of DNA which compares the DNA sample of four persons to the dead…

Q: True or False: It can be considered that mutations are cause for both disease and evolutionary…

A: A mutation is a change in the structure of a gene, the unit of heredity.

Q: Explain each steps in Centrol Dogma

A: The central dogma was proposed by Francis Crick in 1958, it explains how information in DNA has…

Q: What is meant by the term induction?

A: Embryonic induction describes the embryonic process in which one group of cells, the inducing…

Q: In 1-2 sentences, explain why mutations can be beneficial to an organism.

A: A mutation is a sudden and abrupt change in the structure and function of the chromosome.

Q: In eassy form Why is "consent" important in conducting clinical trials?

A: Consent is the permission taken from an adult who is above the age of 18 years for the willingness…

Q: Explain the expression configurational induction. Use a specific example to explain it and draw the…

A: In embryology, induction is the process through which one tissue influences the development of…

Q: Question 5 Mutations are random events. True or False

A: Mutation means a change in DNA sequence.It can results from DNA copying mistakes made during cell…

Q: Similarities in ____ are the basis of similarities in traits

A: Expressed traits are due to the presence of similar types of proteins. Expressed traits are called…

Q: What is the Lyon's Hypothesis--Who is Mary Lyon's

A: Mary Lyon (1924 - 2014) was British geneticist. He gave lyonization or Lyon hypothesis or X…

Q: 1. What is an allele? 2. What is a point mutation? 3. How are point mutations related to alleles?…

A: Note: I have answered These questions based on my knowledge, we are not supposed to answer questions…

Q: What is the importance of central dogma

A: DNA contains genetic information in the form of nucleotide sequences. DNA is composed of four…

Q: do you think someone should be convicted of a crime solely on the basis of a DNA fingerprint

A: Every cell, organ, and tissue in an organism has the same DNA fingerprint. DNA fingerprinting has a…

Q: Define the meaning of Central Dogma

A: Gene is a molecule that is present on the chromosome and contain DNA . DNA is a genetic material…

Q: Explain, the ‘Null hypothesis’ term by through an example.

A: Null hypothesis. It is a kind of hypothesis which is used in statistics. It proposes that there is…

Q: Which is an application of genetic engineering

A: Genetic engineering permits researchers to move desired genes from one plant or creature into…

Q: Each set consist of five key players in the process involved in the central dogma. Choose ONLY two…

A: The biological process by which the information encoded inside a DNA (deoxyribonucleic acid)…

Q: What is the Hebb's Postulate? State it simply in your answer.

A: Introduction The Hebbs postulate was given by Donald Olding Hebb. He was a Canadian psychologist who…

Q: Central Dogma?

A: Central dogma was first proposed by Francis Crick in 1958. It is the process by which the…

Q: Suppose you wanted to create a dichotomous key to identify yourself within your class. What are two…

A: A dichotomous key is a tool created by scientists to help scientists and laypeople identify objects…

Q: Is Central Dogma universal phenomenon? and Does Central Dogma always apply?

A: Introduction: The process by which the directions in DNA are turned into a functioning product is…

Q: Explain gene effect and give an example

A: The gene effects are the effect that leads to a mutation in a gene, these are inheritable changes…

Q: Which of the following terms would blue eyes represent in an organism? A. genotype B. phenotype C.…

A: The characteristics of an organism is determined by the expression specific genes which controls the…

Q: Which of the following is an example of codominance? Select

A: In the codominance both the alleles are expressed in heterozygous state. The alleles are neither…

Q: what is the centeral dogma of biology?

A: The central dogma is a set of processes through which the information stored in DNA is converted…

Q: Is it always good to accept a valid deductive argument? Please explain your answer with an example.

A: A valid deductive argument is a statement that should not be necessarily true to be considered as…

Q: For this question, you will be comparing and contrasting: Meselson & Stahl's experiment and Beadle &…

A: Genetics is the study of the transfer of certain traits (eye color, hair color) and diseases from…

Q: In 3-4 sentences, explain the difference between a null hypothesis and an alternate hypothesis.…

A: The Null Hypothesis (H0) The null hypothesis relates to a statistical method of interpreting…

Q: Which conclusion is supported by the results shown by the Punnett square?

A: Ans. As the disease, Tay-Sachs disease is caused by a recessive gene so it will only be seen in…

Q: Genes are composed of _________________ and are linearly arranged on _________________.

A: Genes are made of DNA i.e., they are composed of nucleic acids along with the variety of proteins…

Q: Question 10. Identify the three ways that a karyotype can be organized

A: Karyotyping: Karyotyping is a test that looks at the chromosomes of a group of cells. This test can…

Q: Large χ2 values are sometimes obtained in situations where the null hypothesis is true. Explain why…

A: A null hypothesis is a type of hypothesis that proposes that no statistical significance exists in a…

Q: What definition does Blackburn (1996) use?

Q: Read the following abstract. Four of the answers can be correctly inferred from the abstract,…

A: 'Parasitoid' is the term given to an organism which survives in a host and extracts all essential…

Q: Explain how you will provide genetic testing information to insurance companies. Be sure to support…

A: Genetic testing information are results that can be used to predict the onset of diseases, or to…

Question

100%

Each set consist of five key players in the process involved in the central dogma. Choose ONLY two items that perform same fuction.

1
RPA
PCNA
SSBP
TF
RF
TF
RF
Peptidyl transferase
eRF
DNA helicase
DNA ligase
DNA pol a
DNA pol II
DNA topoisomerase
RNAse H
Replication fork
DNA pol I
DNA gyrase
DNA pol a
2.
3.
4.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Step 5

Step 6

Step by step

Solved in 6 steps with 4 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
8 of 15 3-6 Insert Plasmid GITAA In this diagram, name the enzyme that converts the DNA substrates on the left into the product on the right. O Terminal transferase O Phosphatase O Topoisomerase O Ligase O Glycosylase
Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
22.124 Give two reasons why bacterial cells am wred for recombinant DNA procedures. Nucleic Acids 1015 22.125 What role do plasmids play in recombinant Polymerase Chain Reaction (Section 22.15) 22.131 What is the function of the polymerase chain DNA procedures? 22.126 Describe what occurs when a particular restric- reaction? tion enzyme operates on a segment of double- stranded DNA. 22.127 Describe what happens during transformation. 22.128 How are plasmids obtained from E, coli bacte- 22.132 What is the function of the enzyme DNA polymerase in the PCR process? 22.133 What is a primer and what is its function in the PCR process? 22.134 What are the four types of substances needed to carry out the PCR process? ria? 22.129 A particular restriction enzyme will cleave DNA Sequencing (Section 22.16) DNA between A and A in the sequence AAGCTT in the 5'-to-3' direction. Draw a dia- gram showing the structural details of the "sticky ends" that result from cleavage of the following DNA segment.…
11.5 A A Aa-AE-E-¹5- U - abe X₂ X² A-ay-A- Font Ulla Unigriffin DNA: mRNA: amino acids: traits: DNA: traits: mRNA: amino acids: · DNA: mRNA: to search #N O E Et CE- Paragraph $ 15 Ser 1. CAT AGG GAG | CAA GGG TGA CTT TTT | AAT AAT GAC GGG | A E ALT | CAA TTG TTA CGG | AAA AGA CCC | GCC ATA ACA TTT | % STP | CAC CGT CGA | GTA GTA | AGA GGG CAT | TTG TAA GGA GGG GGG TGT | 16 AaBbCcDc AaBbCcl AaBbCcL Aa BbCcDc 1 Normal 1 Body Text 1 List Para... 1 No Spac... W] Tyr 17 Val & 7 Gly E CO OM no num lk T Aa Bb Cc 1 Table Pa (p)) Styles 12 P
#3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.
Given the diagram of the replication fork below, indicate the chemical group (5'-P, 3'-P, 3'-OH or 5'-OH) most likely to be found at the sites indicated below by the dots labeled A, B, and C.