1. An individual is heterozygous (CT) for a common C/T SNP that is tested using the Axiom microarray (used by the UK Biobank). Two left apex probes at different spots on the microarray will interrogate this SNP, testing both strands of the SNP. Draw the genomic DNA hybridized to both probes and show the dideoxynucleotides added, the fluorescence observed, and the signal recorded at each spot.

1. An individual is heterozygous (CT) for a common C/T SNP that is tested using the Axiom microarray (used by the UK Biobank). Two left apex probes at different spots on the microarray will interrogate this SNP, testing both strands of the SNP. Draw the genomic DNA hybridized to both probes and show the dideoxynucleotides added, the fluorescence observed, and the signal recorded at each spot.

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter15: Studying And Manipulating Genomes

Section: Chapter Questions

Problem 9SQ: An individuals set of unique _______ can be used in DNA profiling. a. DNA sequences b. short tandem...

See similar textbooks

Similar questions

1. Why do we need to check the isolated DNA for its quantity and quality? 2. The purity of DNA sample is below 1.8 A260/A280 so, where did the proteincontamination come from? Note: Cite the in-text citation and references
5. Show the separation pattern of the following DNA molecules on an agarose gel electrophoresis. 5 kbp 5 kbp 5 kb 5 kbp ----
5) Explain why phenol:chloroform is used in the isolation of genomic DNA ( What is the end result and what must you do for the desired effect
An optimum ligation reaction should contain approximately 50 ng of vector. Given yourconcentrations recorded below, what is the volume of vector that should be added to eachligation reaction to have this mass of DNA in the reaction? Size of asPink-promoterless in bp: 702 (vector) Size of pCusC in bp: 157 The concentration of digested & purified PCR insert: 13.849 The concentration of digested and purified plasmid: 6.887 Any help with this is appreciated. I'm a bit confused thx
#16) The restriction enzymes Xhol and SalI cut their specific sequences as shown below: XhoI 5' C | TCGAG 3' SalI | 5' GTCGAC 3' 3' GAGC | TC 5' 3' G | AGCTG 5' Can the sticky ends created by XhoI and SalI sites be ligated? If yes, can the resulting sequences be cleaved by either XhoI or SalI?
I) Indicate 2 differences between SSLP (simple sequence length polymorphism) and SNP (single nucleotide polymorphism)
Microarray hybridization is used mostly in transcript profiling or assaying DNA variation. Although the technology for establishing DNA microarrays was developed only recently, numerous applications have already been developed and their impact on future biomedical research and diagnostic approaches is expected to be profound. Give some examples of the practical use of this technique.
Explain why we choose to use 1% agarose gel for Electrophoretic Analysis of DNA via Agarose gel Electrophoresis
1) Briefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing, with reference to a published protocol from a company that supplies regents and kits for DNA extraction (e.g Qiagen, ThermoFischer, Invitrogen, or similar). Please Include the weblink for the published protocol you used as a reference. (Word limits: 300) 2) Why was there a greater A260 absorbance reading for your DNA sample that was incubated at higher temperatures. (Word Limits: 100)
All of the following are performed during restriction fragment length polymorphism analysis. 1. splitting of double-stranded into single-stranded DNA 2. gel electrophoresis 3. autoradiography 4. immersion in radioactive probes 5. digestion of DNA with restriction endonucleases 6. use of a positive charge to transfer single-stranded DNA from a gel to a membrane. The correct sequence of these operations is what
Below are 9 possible primer pairs.● Determine which primer pair is the best choice.● Explain why the other primers are not good choices.● Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best.Forward 1: 5’ gaaataattttgtttaactttaag 3’ Tm =Reverse 1: 5’ gtttaagacaaaatagtctgg 3’ Tm =Forward 2: 5’ gtaactcagctttcaggtcg 3’ Tm =Reverse 2: 5’ tctcggaatgttgcaacagc 3’ Tm =Forward 3: 5’ agattagcggatcctacctg 3’ Tm =Reverse 3: 5’ atgtgtaatcccagcagcag 3’ Tm =Forward 4: 5’ cattgattatttgcacggcg 3’ Tm =Reverse 4: 5’ aaaatcttctctcatccgcc 3’ Tm =Forward 5: 5’ tccataagattagcggatcc 3’ Tm =Reverse 5: 5’ tgcaagcttggctgttttgg 3’ Tm =Forward 6: 5’ gatcctacctgacgcttttta 3’ Tm=Reverse 6: 5’ aaataatgaattcgagctcggt 3’ Tm =Forward 7: 5’ataaaaaaatcgagataaccgtt 3’ Tm =Reverse 7: 5’aggtcgactctagaggatc 3’ Tm =Forward 8: 5’ctacctgttccatggccaac 3’ Tm=Reverse 8: 5’ ttcgggcatggcactcttg 3’ Tm=Forward 9: 5’ tccataagattagcggatcc 3’ Tm =Reverse 9: 5’…
3A.Below are a few (of the many) possible errors that could adversely affect PCR or analysis of PCR products. Explain why these errors are bad and predict if the error would lead to no product or just a low yield. i) Primer and DNA volumes reversed (2.5 µl primer and 22.5 µl cheek DNA) ii) Student is homozygous for a mutation that deletes the four bases that would normally anneal to the last four bases at the 3´end of the primer iii) The PCR tube was not capped tightly (prior to the tube being placed in the thermal cycler) iv) While preparing a sample of the PTC PCR reaction to run on a gel, you intend to pipet up 8 µl of FD1 loading dye, but inadvertently depress the pipet plunger to the second stop instead of the first stop. How would this pipetting error affect your conclusions from the Flash Gel? Note: the error was made while preparing the sample with dye not while loading the gel.