People with a commonly occurring, wild type allele of PTC with two adjacent thymines at a particular site in the coding sequence are more prone to BCCs than people without this allele. How can this be explained (one sentence)? The "two adjacent thymines" allele of PTC causes a bigger increase in BCC risk for people xeroderma pigmentosum (XP), who lacks components of the nucleotide excision repair pathway, compared to people without XP. How can

People with a commonly occurring, wild type allele of PTC with two adjacent thymines at a particular site in the coding sequence are more prone to BCCs than people without this allele. How can this be explained (one sentence)? The "two adjacent thymines" allele of PTC causes a bigger increase in BCC risk for people xeroderma pigmentosum (XP), who lacks components of the nucleotide excision repair pathway, compared to people without XP. How can

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter12: Genes And Cancer

Section: Chapter Questions

Problem 16QP

See similar textbooks

Similar questions

There are two types of excision repair, base excision repair (BER) and nucleotide excision repair (NER). Which enzymes are used in Base excision repair in E. coli?And In nucleotide excision repair, what kind of damage is repaired by this mechanism and why are cutsmade on both sides of the damaged region of DNA?
According to the double-strand break model, does gene conversionnecessarily involve DNA mismatch repair? Explain.
Xeroderma pigmentosum is a genetic disease caused by an error in the nucleotide excision repair process that fixes damage to DNA by ultraviolet light. Studies have shown that it can result from mutations in any one of seven genes. What can you infer from this finding? A) There are seven genes that produce the same protein B) These seven genes are the most easily damaged by ultraviolet light. C) There are seven enzymes involved in the nucleotide excision repair process. D) These mutations have resulted from translocation of gene segments.
STR sites are the basis of the FBI Laboratory's Combined DNA Index System (CODIS). One STR site that is used in CODIS is TPOX, named for its location within an intron of the thyroid peroxidase gene located on human chromosome 2. Different versions of the TPOX site are known, due to varying number of repeats of the short sequence "AATG". For TPOX, the number of repeats found on different chromosomes varies from 6 to 13. Hence the "alleles" of this site are called "6", "7", "8", "9", "io", "11", "12" and "13". Any given individual can be homozygous for any one of these eight different alleles or heterozygous for two different alleles of this set. The frequency of any given genotype, however, depends upon the individual frequency of each of these eight alleles in the population. For example, allele "6" occurs at a frequency of less than 5%, allele "11" at a frequency of 20% and allele 8" at a frequency of about 46%. See below for the double stranded DNA sequence of the *11" allele and a…
What is the purpose of DNA methylation? Why is it ineffective in the DNA repair of spontaneous deamination of C? Explain in 4 to 6 sentences.
A certain section of the coding (sense) strand of some DNA looks like this: 5'- ATGGGCCACTCATCTTAG-3' It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. I Don't Know mutant DNA 5'- ATG GGCCACAGTTCTTAG-3' 5'- ATG GG CTCATCTTAG - 3' 5'- ATG GGCCACGCATCTTAG-3' Submit type of mutation (check all that apply) ооооо O point O silent O noisy ооооо insertion deletion insertion O deletion Opoint Osilent noisy insertion O deletion ооооо Opoint silent O noisy X S Ⓒ2023 McGraw Hill LLC. All Rights Reserved. Terms of Use | Privacy Center Accessibility
A 19 year old female patient is diagnosed with chronic myelogenous leukemia. Karyotype analysis shows that the leukemic cells of this patient are heterozygous for a reciprocal translocation involving chromosomes 9 and 22. However, none of the normal, nonleukemic cells of this patient contain the translocation. a) Describe a molecular test to determine if chemotherapy given to the patient described would be completely succesful. (That is, devise a method to make sure that the patient's blood would be free of leukemic cells.) Be as specific as possible.
Which of the following set(s) of primers a-d could you use to amplify the following target DNA sequence, which is part of the last protein-coding exon of the CFTR gene? Explain briefly. (Note: The three dots represent the body of the region to be amplified, whose beginning and end are only being shown.) 5' GGCTAAGATCTGAATTTTCCGAG . TTGGGCAATAATGTAGCGCCTT 3' 3' CCGATTCTAGACTTAAAAGGCTC . AACCCGTTATTACATCGCGGAA 5' a. 5' GGAAAATTCAGATCTTAG 3'; 5' TGGGCAATAATGTAGCGC 3' b. 5' GCTAAGATCTGAATTTTC 3'; 3' ACCCGTTATTACATCGCG 5' c. 3' GATTCTAGACTTAAAGGC 5'; 3' АССCGTTATTАСАТСGCG 5 d. 5' GCTAAGATCTGAATTTTC 3'; 5' TGGGCAATAATGTAGCGC 3'
Suppose a single-nucleotide polymorphism occurred in the original strand to make the change shown below. Would this affect the resulting protein? Explain. This is the original strand TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC CAA AGG TCT TCA GGG AAT GCC This is the strand with the SNP. (The change is shown in red.) TGG CGA GAG GGG AGC AGC TAG TAT CGC TGG GCC САА AGG TCT TCA GGG AAT GCC Suppose a different single-nucleotide polymorphism occurred in the original strand to make the change shown below. Would this affect the resulting protein? Explain. This is the original strand AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC САА This is the mutated strand. (The change is shown in red). AGG TCT TCA GGG AAT GCC TGG CGA GAG GGA AGC AGC TGG TAT CGC TGG GCC CAA
F ′strains in E. coli are derived from Hfr strains. In some cases, these F ′strains show a high rate of integration back into the bacterial chromosome of a second strain. Furthermore, the site of integration is often the site occupied by the sex factor in the original Hfr strain (before production of the F ′strains). Explain these results.
Homologous recombination in E. coli forms heteroduplex regions of DNA containing mismatched bases. Why are these mismatches not eliminated by the mismatch repair system?
A pyrimidine dimer which is a bulky lesion has mutated an E. coli cell's DNA. Describe both the photoreactivation enzyme repair (PRE) and Nucleotide excision repair describe how the cell uses Uvr A, B, C, D gene products to effect repair.